ID: 1126824212

View in Genome Browser
Species Human (GRCh38)
Location 15:52532740-52532762
Sequence TAGAATAACTAGCTGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126824212_1126824221 17 Left 1126824212 15:52532740-52532762 CCCAACTCCAGCTAGTTATTCTA No data
Right 1126824221 15:52532780-52532802 AGCTTAGGCAACCCTAGGAAAGG No data
1126824212_1126824222 20 Left 1126824212 15:52532740-52532762 CCCAACTCCAGCTAGTTATTCTA No data
Right 1126824222 15:52532783-52532805 TTAGGCAACCCTAGGAAAGGAGG No data
1126824212_1126824220 12 Left 1126824212 15:52532740-52532762 CCCAACTCCAGCTAGTTATTCTA No data
Right 1126824220 15:52532775-52532797 CTGTGAGCTTAGGCAACCCTAGG No data
1126824212_1126824215 2 Left 1126824212 15:52532740-52532762 CCCAACTCCAGCTAGTTATTCTA No data
Right 1126824215 15:52532765-52532787 TGCCCCTCACCTGTGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126824212 Original CRISPR TAGAATAACTAGCTGGAGTT GGG (reversed) Intergenic
No off target data available for this crispr