ID: 1126825050

View in Genome Browser
Species Human (GRCh38)
Location 15:52540301-52540323
Sequence CCCAGTGGGGACCCAGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126825037_1126825050 7 Left 1126825037 15:52540271-52540293 CCCTCTTCTCACAACCCCAGTAG No data
Right 1126825050 15:52540301-52540323 CCCAGTGGGGACCCAGAGTGGGG No data
1126825038_1126825050 6 Left 1126825038 15:52540272-52540294 CCTCTTCTCACAACCCCAGTAGG No data
Right 1126825050 15:52540301-52540323 CCCAGTGGGGACCCAGAGTGGGG No data
1126825043_1126825050 -9 Left 1126825043 15:52540287-52540309 CCAGTAGGCAGAGCCCCAGTGGG No data
Right 1126825050 15:52540301-52540323 CCCAGTGGGGACCCAGAGTGGGG No data
1126825041_1126825050 -8 Left 1126825041 15:52540286-52540308 CCCAGTAGGCAGAGCCCCAGTGG No data
Right 1126825050 15:52540301-52540323 CCCAGTGGGGACCCAGAGTGGGG No data
1126825040_1126825050 -7 Left 1126825040 15:52540285-52540307 CCCCAGTAGGCAGAGCCCCAGTG No data
Right 1126825050 15:52540301-52540323 CCCAGTGGGGACCCAGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126825050 Original CRISPR CCCAGTGGGGACCCAGAGTG GGG Intergenic
No off target data available for this crispr