ID: 1126825936

View in Genome Browser
Species Human (GRCh38)
Location 15:52547994-52548016
Sequence TGATAACTAAAGCAGTTTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126825936_1126825938 0 Left 1126825936 15:52547994-52548016 CCACCAAACTGCTTTAGTTATCA 0: 1
1: 0
2: 1
3: 6
4: 162
Right 1126825938 15:52548017-52548039 CTCAGAAGTGCTCTTCCCATTGG 0: 2
1: 1
2: 0
3: 17
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126825936 Original CRISPR TGATAACTAAAGCAGTTTGG TGG (reversed) Exonic
900277287 1:1839364-1839386 TGCTAAATAAAGCAATTTTGGGG - Intronic
904968616 1:34401112-34401134 AGCTACCTAAAGCAGTCTGGTGG + Intergenic
905417172 1:37811959-37811981 AGTTCACTAAGGCAGTTTGGTGG + Exonic
908006689 1:59735283-59735305 TGTTAACTAAAGCAGGAAGGAGG - Intronic
914809100 1:151013726-151013748 TGCTCACTGAAGCAGTTAGGGGG - Intronic
918639627 1:186824016-186824038 AGATAAATAAAGGAGTTGGGTGG + Intergenic
918964776 1:191329128-191329150 TGAGAAATAAATCAGTTTAGGGG - Intergenic
920253471 1:204638239-204638261 TGAACACTAAAGCAGGTCGGAGG - Intronic
924209704 1:241751982-241752004 TGATAAACAAAGCACTATGGGGG + Intronic
924698092 1:246420834-246420856 AGATAACCAACCCAGTTTGGAGG + Intronic
924940252 1:248808388-248808410 TTATCAGTACAGCAGTTTGGAGG - Intergenic
1065466612 10:26031186-26031208 TAAAAAGTAAAGCAGTTTAGCGG + Intronic
1068722562 10:60262389-60262411 TCATGACAAAAGCAGTTTTGGGG + Intronic
1069075032 10:64030346-64030368 TGATCATTACAGCAATTTGGAGG + Intergenic
1069998239 10:72356454-72356476 AGACTACAAAAGCAGTTTGGTGG + Intergenic
1070347397 10:75558247-75558269 GTCTAACTAAGGCAGTTTGGGGG + Intronic
1070465621 10:76720655-76720677 TGTTAATTAAAACAGTATGGAGG - Intergenic
1070713404 10:78700029-78700051 TCATAACTGAACCAGATTGGAGG - Intergenic
1071747339 10:88437010-88437032 TGATGCTTACAGCAGTTTGGGGG + Intronic
1074792200 10:116901524-116901546 TGATTACCAAACCAGTTTAGGGG + Intronic
1074931972 10:118137139-118137161 TAGTAAGTAAAACAGTTTGGAGG - Intergenic
1079596454 11:22254774-22254796 TGATAATTCCAGCACTTTGGGGG + Intronic
1083259248 11:61514328-61514350 TGATATCTAAACCAGGTTGTGGG + Intergenic
1087259889 11:95999484-95999506 TTATAGTTAAAGCAGTTTTGTGG + Intronic
1088272896 11:108053447-108053469 TGATAACTAAAAGAATATGGGGG - Intronic
1092163121 12:6327142-6327164 TGATACCAAAATAAGTTTGGAGG + Intronic
1095950539 12:47779534-47779556 TGCTAACTAAAGCAGGTTGGAGG + Intronic
1100128604 12:91461717-91461739 TGGTAACAAAAACAGTATGGTGG + Intergenic
1100487092 12:95040517-95040539 TGATAAGAACAGCAGTCTGGAGG + Exonic
1100652669 12:96607588-96607610 TGAAAACAAAAGAAGTCTGGAGG + Intronic
1101413239 12:104486420-104486442 TGATGACTTCAGCTGTTTGGGGG + Intronic
1103026680 12:117579834-117579856 TGCAAACTTGAGCAGTTTGGAGG + Intronic
1104106522 12:125665182-125665204 TGTTAAGTAAAGCATATTGGTGG - Intergenic
1105656240 13:22442210-22442232 GGATAACCAAGGCAGTTTTGAGG - Intergenic
1108343242 13:49518260-49518282 TGAGAACAAAGCCAGTTTGGGGG + Intronic
1108407739 13:50122540-50122562 TGATAGCTAAAGCAGTGGGAGGG - Intronic
1108560594 13:51640356-51640378 TGATAACTAAAGCTGCATGACGG - Intronic
1110458285 13:75714851-75714873 TAATAGCTAAAGTAGTTTGCAGG - Intronic
1111596465 13:90418354-90418376 TGATTACTGCAGCTGTTTGGTGG + Intergenic
1116274017 14:42807076-42807098 TGAGAACTGAAGGAGTTTGTTGG - Intergenic
1119817957 14:77587786-77587808 TAATAACTAATGCTGTTTGCTGG + Intronic
1120069552 14:80087706-80087728 TCATAATTAAGACAGTTTGGTGG - Intergenic
1120698740 14:87674290-87674312 TGACAACTTGAGCAGTTTTGAGG + Intergenic
1122447100 14:101777685-101777707 TGATATGGAAAACAGTTTGGTGG - Intronic
1124808579 15:32910818-32910840 TTAAAACTAAATCAGTTTGTAGG + Intronic
1126825936 15:52547994-52548016 TGATAACTAAAGCAGTTTGGTGG - Exonic
1128570380 15:68729322-68729344 TGATAATTAAAGCAATGTGTTGG - Intergenic
1128850993 15:70955475-70955497 TTATAACTAATCCAGTTTTGAGG + Intronic
1133722769 16:8510369-8510391 TTAAAACTAAATTAGTTTGGAGG + Intergenic
1135306400 16:21371034-21371056 TGCTTACAAAAACAGTTTGGAGG + Intergenic
1140157491 16:72447148-72447170 TCCTAGCTAAAGCAGTTAGGGGG - Intergenic
1145134794 17:20393310-20393332 AGAGAACTAAAGCAGCATGGAGG - Intergenic
1151589982 17:75036872-75036894 TGTTGACTCAAGCAGTTTTGGGG + Intronic
1151813212 17:76457340-76457362 TGACAACAAAAGCAGATTTGAGG - Intronic
1152582906 17:81175935-81175957 TGATAACTAAAAAAATTTGTGGG + Intergenic
1153136701 18:1925740-1925762 TGAGAACAGAAGGAGTTTGGGGG - Intergenic
1153831550 18:8928255-8928277 TGCTGAGGAAAGCAGTTTGGTGG + Intergenic
1154058947 18:11040454-11040476 TGATAAGTAAAGCAATTCTGTGG + Intronic
1155841292 18:30645883-30645905 TTCTAACTGAAGCATTTTGGAGG - Intergenic
1158276084 18:55769052-55769074 TGGGAACTAAAGCAGGTGGGAGG - Intergenic
1159162823 18:64666145-64666167 TGATAAATAAAACAGTCAGGTGG - Intergenic
1163265174 19:16216470-16216492 GGAGAACTACTGCAGTTTGGAGG + Intronic
928363526 2:30684615-30684637 TGCAAACCAAAGCAGTTTCGAGG - Intergenic
928488700 2:31758567-31758589 TAATAACCAAACCAGTTTGGAGG + Intergenic
930243611 2:48961099-48961121 TGATCCCAAAAGCATTTTGGAGG - Intergenic
930984405 2:57567680-57567702 TTCTAAATAAAGCAGTTTGGGGG + Intergenic
931910742 2:66897174-66897196 TGATAACAAAAGCATTCTGGAGG + Intergenic
933117398 2:78492021-78492043 TGATAACTCAAGCATTTATGTGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
935320642 2:101885110-101885132 AGACAACTAAAACAGTTTAGAGG + Intronic
935690963 2:105732219-105732241 ACATCTCTAAAGCAGTTTGGGGG - Intergenic
935834661 2:107037289-107037311 TGATAACTTTAGCAGTGGGGTGG - Intergenic
937586429 2:123557160-123557182 TAATAAGTAAAGCAGATTAGAGG - Intergenic
940185430 2:150979677-150979699 TGTTAACCAAAGCACTTTTGGGG - Intergenic
941592510 2:167437437-167437459 TGATAACTTCTGCAATTTGGAGG + Intergenic
942586336 2:177483084-177483106 TGATATCCAGAGCAGTGTGGAGG + Intronic
942899750 2:181100481-181100503 TGATAATTAATGGATTTTGGGGG - Intergenic
943918835 2:193675944-193675966 TTATAGATAAATCAGTTTGGGGG - Intergenic
945916027 2:215704790-215704812 TGATTATTAAATCAGTTGGGTGG + Intergenic
947700294 2:232228580-232228602 TGGTGACTAAAGCACTTTGCAGG - Intronic
1172968332 20:38855264-38855286 TAATAACAAAAGCTCTTTGGAGG + Intronic
1173272732 20:41553177-41553199 TCAAAAATAAAGAAGTTTGGGGG + Intronic
1174584149 20:51594390-51594412 GGGTAACTCAAGCACTTTGGGGG - Intergenic
1175559299 20:59906359-59906381 TGATAAATAGAACAGATTGGAGG + Intronic
1176103783 20:63376251-63376273 TGATAACTCAACCATTTTTGGGG + Intronic
1179842983 21:44089342-44089364 TGAAAACCAAATCAGTTTAGGGG - Intronic
1182207290 22:28641469-28641491 TGATATGGAAAGCAGATTGGTGG + Intronic
950059303 3:10056390-10056412 TGCTATGGAAAGCAGTTTGGTGG - Intronic
950201760 3:11049527-11049549 TAAGAGCTAAAGGAGTTTGGAGG + Intergenic
950300789 3:11876323-11876345 TGCTATGGAAAGCAGTTTGGTGG - Intergenic
951517282 3:23574547-23574569 TTATAAAGAAAGCAGTTTGCAGG + Intronic
954460150 3:50621880-50621902 TGACCCCTAAAGCATTTTGGAGG + Intronic
955093662 3:55775973-55775995 GGATAAAGAAAGCAGTTTGGTGG + Intronic
955647084 3:61151383-61151405 AGATAAATAATGCAGTTTTGAGG - Intronic
955802884 3:62704443-62704465 TGATATCTAAGGAAATTTGGTGG + Intronic
955869267 3:63419284-63419306 TGATGGCTATAGCAGTTTTGAGG - Intronic
955872344 3:63452301-63452323 TGATAATTAAATCACTTTTGAGG - Intronic
956530091 3:70208810-70208832 TGAAAACCAAGGCTGTTTGGAGG - Intergenic
958157633 3:89774678-89774700 AGATAACTCGAGCAGTGTGGAGG + Intergenic
958901241 3:99888619-99888641 TGATAGGTTAAGCAGTTAGGAGG - Intronic
959240647 3:103788119-103788141 TGATAAATATAGCATTTAGGTGG + Intergenic
962810832 3:138958143-138958165 TGATAGCTACAGTAGTTTTGGGG - Intergenic
964134819 3:153332940-153332962 TGATATCTTAAGCAGTTTATAGG - Intergenic
964723332 3:159789735-159789757 TGATAACAAAATCAGTTTCTGGG - Intronic
965719296 3:171644073-171644095 TGGTAAGTAAAGCAGATTAGGGG - Intronic
966466827 3:180238516-180238538 TGATGCCTCAAGCATTTTGGTGG - Intergenic
967408483 3:189143390-189143412 TGATAAATAAGGAAGTTAGGAGG + Intronic
973963476 4:56135337-56135359 TGACAACTCAAGCAGTTTCTTGG + Intergenic
973974778 4:56252184-56252206 AGATAAGTAAAGCAGTTTTTTGG - Intronic
978232433 4:106416315-106416337 TGAGTCCAAAAGCAGTTTGGAGG + Intergenic
978557300 4:109994500-109994522 TGATACATAAAGCATATTGGAGG - Intronic
978619943 4:110628167-110628189 TGAGAACTAAAGTAGTTGGTAGG - Intronic
979882599 4:125980738-125980760 TGAAAATTAAAACAATTTGGAGG + Intergenic
981918839 4:150064598-150064620 TGACAATTAAATCTGTTTGGGGG + Intergenic
982108281 4:152030135-152030157 TAACATCTAAAGCATTTTGGAGG - Intergenic
982298323 4:153853008-153853030 GGATGACTAAAGGACTTTGGGGG + Intergenic
983108026 4:163714415-163714437 TGCTAATGAAATCAGTTTGGGGG + Intronic
983214638 4:164991816-164991838 TGATATTTAAAGCAGTCTGAGGG - Intergenic
984739112 4:183142037-183142059 TGTTGAGGAAAGCAGTTTGGTGG + Intronic
998622158 5:143806776-143806798 TTACAAATAAAGCCGTTTGGAGG - Intergenic
1003013572 6:2449684-2449706 TAATAACTAACTCTGTTTGGTGG + Intergenic
1003125127 6:3349680-3349702 TGATATTTAAAGCACTTGGGTGG - Intronic
1006571767 6:35011410-35011432 TGAAAACTAGGGAAGTTTGGGGG + Intronic
1007428081 6:41759994-41760016 TGAGAACTAGAGCAGATAGGGGG + Intergenic
1008072284 6:47109805-47109827 TGAAAACTAATGTAGTATGGTGG + Intergenic
1008908045 6:56701333-56701355 TGATACCTCAAGCAAGTTGGGGG + Intronic
1010073668 6:71774104-71774126 GGAGAACTGAAGTAGTTTGGAGG + Intergenic
1011667590 6:89649939-89649961 TCATATTTAAAGCATTTTGGTGG + Intronic
1011947048 6:92918608-92918630 TGAAAACTCCAGCAGTTTTGAGG - Intergenic
1013781502 6:113733518-113733540 TGATATATAAATTAGTTTGGGGG + Intergenic
1015574698 6:134659095-134659117 TGGTAGCTAAAGCAGTGTAGGGG + Intergenic
1015915088 6:138208209-138208231 TGTTAACTGAAGCAACTTGGTGG + Intronic
1016202759 6:141431875-141431897 TGATAACTTTAACAGTTTTGAGG - Intergenic
1020361579 7:7332241-7332263 AGATAAAGAAAGCATTTTGGTGG + Intergenic
1021312216 7:19108925-19108947 TGATACCAAGAGCAGTTTGGTGG - Intronic
1023044292 7:36197441-36197463 TGATGACGATAGCAGTTTTGTGG + Intronic
1027003313 7:74670013-74670035 TGATAATTAATGCAGTTTGTTGG + Intronic
1028703122 7:93806440-93806462 AAATGACTAAAGCAGTCTGGAGG - Intronic
1029519582 7:101051687-101051709 TGATAACACAAGGGGTTTGGGGG + Intronic
1030346318 7:108436837-108436859 TGATATGTATAACAGTTTGGAGG + Intronic
1031673605 7:124581846-124581868 TGATAACCATATGAGTTTGGAGG + Intergenic
1031676706 7:124619491-124619513 TGATAGCTAAAGAAGTGTGACGG + Intergenic
1031768338 7:125809323-125809345 TGAGAACAAAAGCAGATTTGAGG + Intergenic
1031867535 7:127054403-127054425 TGATATATTAAGCAGTTTAGTGG - Intronic
1035488607 7:159252471-159252493 TTTTGACTTAAGCAGTTTGGTGG - Intergenic
1037628170 8:20626895-20626917 TAATAACTATTCCAGTTTGGGGG - Intergenic
1038299497 8:26329720-26329742 TGGTAAGTAAAACAGTTTGTAGG - Intronic
1038938462 8:32278301-32278323 TGAAAAATAGAGCAATTTGGGGG + Intronic
1039835719 8:41254824-41254846 GGCTTCCTAAAGCAGTTTGGAGG + Intergenic
1041324398 8:56649643-56649665 TGAGAACTAAATCAGTATGAGGG - Intergenic
1043321707 8:78994836-78994858 TAATAACCAAAACAGTATGGTGG - Intergenic
1043836645 8:85055031-85055053 TGATAACTAAGGAAGACTGGAGG + Intergenic
1044830408 8:96241934-96241956 GGATAACAAAAGCAGTTTTAGGG - Intronic
1046652333 8:116850555-116850577 TGAAAAATAAAGCTGGTTGGAGG + Intronic
1047051857 8:121121703-121121725 AAATACCTAAAGCTGTTTGGAGG + Intergenic
1050143295 9:2538868-2538890 TGATACCTAAATGGGTTTGGGGG + Intergenic
1051546011 9:18276066-18276088 GGATAACTAAAGACTTTTGGTGG - Intergenic
1052343624 9:27386436-27386458 TGAAAACTAAAGCAGATTAAAGG + Intronic
1057770821 9:97966399-97966421 TGATTACCAAAACAGTCTGGAGG + Intergenic
1058749493 9:108025376-108025398 TGATAAGTAAGGGGGTTTGGGGG - Intergenic
1187396286 X:18922328-18922350 TGGTAACTGAAGCAAATTGGAGG + Intronic
1190094150 X:47465342-47465364 TGAGATCTATTGCAGTTTGGTGG + Intronic
1193593055 X:83413189-83413211 TAATAAAAAAAACAGTTTGGGGG + Intergenic
1194079761 X:89445487-89445509 TGAAAACTAAAGGAGCTTTGAGG + Intergenic
1198299722 X:135323406-135323428 TGACAACAAAAGCATTTTGTAGG + Intronic
1198533860 X:137568268-137568290 GGAAAGCTAAAGCAGTTTCGTGG + Intronic
1198778206 X:140204450-140204472 TGATAACTTTGGCAGTTTTGAGG + Intergenic
1199707230 X:150438916-150438938 TGCTATCAAAAACAGTTTGGCGG - Intronic
1199915199 X:152332089-152332111 AGATAACTACAGCATTTTGATGG - Intronic
1200432379 Y:3100776-3100798 TGAAAACTAAAGGAGCTTTGAGG + Intergenic