ID: 1126832900

View in Genome Browser
Species Human (GRCh38)
Location 15:52627142-52627164
Sequence TATCAGGTTTAGAATTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126832900_1126832905 0 Left 1126832900 15:52627142-52627164 CCACCCAAATTCTAAACCTGATA 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1126832905 15:52627165-52627187 CTTTCAAAGTTGCAAAAGAAGGG 0: 1
1: 0
2: 0
3: 39
4: 410
1126832900_1126832904 -1 Left 1126832900 15:52627142-52627164 CCACCCAAATTCTAAACCTGATA 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1126832904 15:52627164-52627186 ACTTTCAAAGTTGCAAAAGAAGG 0: 1
1: 0
2: 1
3: 21
4: 320
1126832900_1126832906 30 Left 1126832900 15:52627142-52627164 CCACCCAAATTCTAAACCTGATA 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1126832906 15:52627195-52627217 TGAGTCAGAAAATACCTAAGAGG 0: 1
1: 0
2: 0
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126832900 Original CRISPR TATCAGGTTTAGAATTTGGG TGG (reversed) Intronic
903991371 1:27272389-27272411 TATCATGTTTAAAAATTGGCTGG - Intronic
904388883 1:30166094-30166116 TATCAGCTTTAGATTTGGTGGGG + Intergenic
908464582 1:64379612-64379634 TTTCAGATTAAGAATTTGTGGGG + Intergenic
912302625 1:108533864-108533886 TAGCAGGTTTGGGGTTTGGGTGG - Intergenic
915555931 1:156660832-156660854 TTTCAAGTTTAGAAATAGGGTGG - Intergenic
918573032 1:186021328-186021350 TTTGAGTTTTAGATTTTGGGGGG + Intronic
920088380 1:203434492-203434514 GAGCAGGTATAGGATTTGGGTGG - Intergenic
921117091 1:212102507-212102529 TATCTTGTTTATAAATTGGGGGG + Intronic
921725377 1:218517628-218517650 TATCTGGTTTAGAATTTAGAGGG - Intergenic
921907970 1:220515051-220515073 TGACAGGTTTGAAATTTGGGAGG + Intergenic
1064986661 10:21217175-21217197 CATCTGTTTTAGATTTTGGGGGG - Intergenic
1069031941 10:63605942-63605964 TCTCAGGTTTTGGATTTAGGTGG - Intronic
1072780762 10:98249858-98249880 TCTAAGGTTTCGAATTTGTGTGG - Intronic
1076097738 10:127745856-127745878 TTTCAGGTTTAGAATGTGTAAGG + Intergenic
1077498339 11:2897428-2897450 TGTCAGGTTAAGAGTCTGGGAGG - Intronic
1078376658 11:10800372-10800394 TATCAGTTTTCGAATTTGAGTGG + Intronic
1078591846 11:12648233-12648255 CATCAGGTTTGGAAGTTGTGGGG - Intergenic
1078745318 11:14108333-14108355 TTAGAGGTTGAGAATTTGGGTGG - Intronic
1081279850 11:41195551-41195573 TATGTGCTTTATAATTTGGGGGG - Intronic
1081888783 11:46522592-46522614 TATAGGGTTTAGAATTTAAGAGG + Intronic
1084848201 11:71917518-71917540 TATTAGGTGTAGACTGTGGGAGG - Intronic
1085302087 11:75464677-75464699 TAGCAGGTTTAGGCTTGGGGAGG + Intronic
1085972687 11:81612181-81612203 TATCTGTTTAAGAATTTGGTAGG + Intergenic
1087290404 11:96314678-96314700 ACTCAGGGCTAGAATTTGGGAGG - Intronic
1089656785 11:119953429-119953451 TTTCATTTCTAGAATTTGGGGGG - Intergenic
1090601437 11:128376278-128376300 GATCAGATTTAGATTTTGGAAGG + Intergenic
1090888829 11:130904577-130904599 TCTCAGGTTTAGCATTTGCTTGG + Intronic
1094109680 12:26848282-26848304 AATCAGGTACAGGATTTGGGGGG + Intergenic
1095161755 12:38925824-38925846 TATCAAGTCTGGAATTTAGGCGG + Intergenic
1096630993 12:52926613-52926635 GATCAGGTTTACAATCAGGGAGG - Intronic
1098519349 12:71418558-71418580 TATAAGGTTTAGCATTGTGGAGG - Intronic
1098602770 12:72352211-72352233 TATCAGCTTTGGAATTTGTTGGG + Intronic
1099320931 12:81147640-81147662 CATCAGGTTTAGAAAAGGGGTGG + Intronic
1099622642 12:85024478-85024500 TATAAGATTTAGAATTTGGCTGG + Intronic
1099652429 12:85445357-85445379 AACCAGGTTTAGAATCTGTGGGG - Intergenic
1099661061 12:85562626-85562648 TATAAGGGTTATATTTTGGGGGG + Intergenic
1100779653 12:98010436-98010458 GAGCAAGTTAAGAATTTGGGGGG + Intergenic
1101276905 12:103212523-103212545 ACTCAGGTTCAGATTTTGGGGGG + Intergenic
1102135151 12:110568024-110568046 TATCATGTTAAGGAATTGGGTGG - Intronic
1105915540 13:24912212-24912234 TATGAGTTTTAGATTTTCGGTGG - Intronic
1109680567 13:65746812-65746834 TATTAGGTTTATTTTTTGGGGGG - Intergenic
1110205726 13:72910715-72910737 TATCAGGTTTAGTAGTTGTTTGG - Intronic
1110242635 13:73285931-73285953 TCTCAGGTTCATGATTTGGGTGG - Intergenic
1110597380 13:77334140-77334162 AATCAGGTTTATTATTTGGATGG - Intergenic
1111977401 13:94980972-94980994 TACCAGGTTCAGTATTTGAGAGG - Intergenic
1115824508 14:37252139-37252161 TTTTAGGTTTATTATTTGGGGGG + Intronic
1116188480 14:41631597-41631619 TATCAAGTGTGGAATTTGAGAGG + Intronic
1116596649 14:46857367-46857389 TGTGAGGTTTAGAATTCAGGCGG + Intronic
1118695782 14:68383766-68383788 TATCAGAGTTAGAATCAGGGTGG + Intronic
1120640975 14:87012300-87012322 TGTCAGGTTCATACTTTGGGTGG + Intergenic
1125106619 15:35979209-35979231 TAAGAGGTGGAGAATTTGGGAGG - Intergenic
1126832900 15:52627142-52627164 TATCAGGTTTAGAATTTGGGTGG - Intronic
1127181617 15:56425537-56425559 TTTCAGCTTTAGAATTTGTTTGG + Intronic
1128187299 15:65653306-65653328 AATCATGTTCTGAATTTGGGTGG + Intronic
1130372268 15:83295082-83295104 ATCCAGGTTTAGAATTTGGTTGG - Intergenic
1132033998 15:98464885-98464907 TATGGGGCTTTGAATTTGGGAGG - Intronic
1138334543 16:56242402-56242424 TAGCAAGTTTTGAAATTGGGAGG - Intronic
1138900045 16:61257583-61257605 AATCAGGTTTAGGAGTGGGGTGG - Intergenic
1139068253 16:63346502-63346524 TATAAGGTTGAGAATCTGGGAGG - Intergenic
1140266237 16:73423563-73423585 TAAGAGGTTTAGAAATTGGCTGG + Intergenic
1144278904 17:13704580-13704602 AATGAGGTTTTGAGTTTGGGAGG - Intergenic
1149433138 17:56610462-56610484 TATATCGTTTAGAATTTGAGGGG + Intergenic
1150065997 17:62109856-62109878 TTTGAGGTTTTGAATTTGGCAGG + Intergenic
1151182743 17:72341749-72341771 TTTGAGGTTTAGAATATTGGCGG - Intergenic
1154468246 18:14670541-14670563 TATCATGCTGAGACTTTGGGAGG + Intergenic
1155131222 18:22936614-22936636 AATCATTTTTAGAATTTGGGAGG - Intronic
1155792430 18:29990391-29990413 GATCAGTTTTAGGATGTGGGTGG - Intergenic
1156165489 18:34415198-34415220 TAATTGGTTCAGAATTTGGGAGG - Intergenic
1156827761 18:41452470-41452492 TTTCTGGTTTAGAATTTGTTAGG - Intergenic
1157996861 18:52568066-52568088 TAACTGGTTTAGTACTTGGGGGG + Intronic
1159688356 18:71452958-71452980 TCTCTGGTTTAGAATTTGGTGGG - Intergenic
1160056662 18:75488813-75488835 TATCTTGTTTTGAATTTGGTGGG + Intergenic
1165284995 19:34834127-34834149 TATAATGTTAAAAATTTGGGAGG - Intergenic
927604965 2:24478527-24478549 CATCAGGCTAAGAATTTGTGGGG + Intergenic
928130240 2:28643791-28643813 AATCAGGTTGAGAATATAGGAGG - Intergenic
930726220 2:54684224-54684246 AATAAGGTTTAAAATTTTGGTGG + Intergenic
930926167 2:56820705-56820727 TATCAGCTTAAGGATTTTGGGGG - Intergenic
931831280 2:66054083-66054105 TAAGAGGTTTGGAATTTGGGAGG - Intergenic
933088032 2:78080870-78080892 TATGAGGTCTAGAATTTATGAGG - Intergenic
935728660 2:106046468-106046490 TTTCTGGTTTAGCATCTGGGTGG - Intergenic
938636935 2:133238241-133238263 TCCCAGGTTTAGAATCTGAGTGG + Intronic
938751520 2:134335532-134335554 AATAAGGTTTAGAAATTGAGGGG - Intronic
939108301 2:137975715-137975737 TGTCAGGTTTAGAAACTAGGAGG + Intronic
939767950 2:146276965-146276987 TATCACTTTTAGTCTTTGGGTGG + Intergenic
942809677 2:179983196-179983218 TACTAGGTTTAATATTTGGGTGG - Intronic
944102156 2:196038662-196038684 AAACAGGTTTAGAATTTGCATGG + Intronic
946667304 2:222064490-222064512 TAGCAGGTGTAGCCTTTGGGAGG + Intergenic
947543870 2:230996862-230996884 TATATGGTTTAGAATAAGGGAGG + Intronic
947567186 2:231201679-231201701 AATCAGGTTAAGAATGGGGGAGG - Intronic
1170755098 20:19195886-19195908 TTTCAGCATAAGAATTTGGGGGG + Intergenic
1173259817 20:41423944-41423966 TACCTGGTTTAGAAATAGGGAGG - Intronic
1174132393 20:48355191-48355213 TCTCAGGTTCAGAAAATGGGTGG + Intergenic
1174642635 20:52057715-52057737 TATCAAGTTTAGAACATGGAAGG - Intronic
1174849656 20:53980225-53980247 TATCAAGTTTACAAGCTGGGTGG - Intronic
1175520698 20:59600828-59600850 TATCTGATCTAGAATCTGGGTGG + Intronic
1176806272 21:13487108-13487130 TATCATGCTGAGACTTTGGGAGG - Intergenic
1177023149 21:15888199-15888221 TATTAAGGTTAGCATTTGGGAGG - Intergenic
1177308278 21:19350166-19350188 TCTCAGCTTTAGAATTTCAGAGG - Intergenic
1177566311 21:22827085-22827107 TAATATGTTTATAATTTGGGGGG - Intergenic
1184966785 22:47981102-47981124 TATTAGGCTTAGTATCTGGGTGG - Intergenic
949621697 3:5820157-5820179 TGTCAGGTTTAGACTTTGTTAGG + Intergenic
953308029 3:41848500-41848522 TTTCAGGTTTTGTATTTGAGGGG - Intronic
953311120 3:41880132-41880154 TTTCAGTTTTAGAATTTGATGGG + Intronic
953707918 3:45245165-45245187 TAGCAGGTTTGGAGCTTGGGAGG + Intergenic
954142572 3:48616695-48616717 TTTCAGGTTCAGAATTTGTTTGG + Intergenic
955578149 3:60388614-60388636 TATCAGGTTTAGGTCTTGTGTGG - Intronic
956339065 3:68200312-68200334 TGTCTGGTTTTGTATTTGGGTGG + Intronic
956881559 3:73516104-73516126 TATCTTGTTTCTAATTTGGGAGG + Intronic
957899218 3:86466708-86466730 TAGCAGGCTTAGAATTTTAGAGG + Intergenic
958625748 3:96622152-96622174 AGTCAGATTGAGAATTTGGGGGG - Intergenic
960299926 3:115990299-115990321 TAATAGGTTTGGTATTTGGGAGG + Intronic
962505622 3:136044100-136044122 TCTCAGGATTAGAAAATGGGTGG - Intronic
963080465 3:141388379-141388401 TATTATGTATATAATTTGGGGGG + Intronic
964684519 3:159380421-159380443 TGTCATGTCTAGAATTTGGGTGG - Intronic
964830494 3:160878769-160878791 TATCAGGTATAGATTATGGAAGG + Intronic
965630136 3:170724700-170724722 AATCAGGATTACCATTTGGGAGG - Intronic
966901489 3:184489948-184489970 TATCGGATTTAGGGTTTGGGGGG - Intronic
967240135 3:187430752-187430774 TAGCAGGTTTTTAATTTTGGTGG + Intergenic
969441505 4:7219788-7219810 TATCAGGCTGGGAATTTGGAGGG + Intronic
971393438 4:26206910-26206932 GAACAGGTATAGAATTTGAGGGG - Intronic
971575852 4:28273630-28273652 TATCAGTTTAAGGATTTTGGGGG + Intergenic
973094972 4:46185766-46185788 CATCAGGGGTAAAATTTGGGGGG - Intergenic
973161691 4:47025949-47025971 CACCAAGTTGAGAATTTGGGAGG - Intronic
976324844 4:83759488-83759510 GAGCAGTTTTAGAATTTGGGGGG - Intergenic
976583237 4:86764835-86764857 ATTCAGTTTTAGAATTTTGGAGG - Intronic
978051549 4:104206681-104206703 TATGAGGTTTAAAGTTTGGGGGG + Intergenic
978517021 4:109579502-109579524 TGTGAGGTTTACACTTTGGGAGG - Intronic
978678375 4:111347261-111347283 TATCAGATTTAGTTTTTTGGGGG + Intergenic
979060825 4:116058784-116058806 TAACAGGCTTTGAATTTGCGTGG - Intergenic
979911456 4:126371911-126371933 TATAAGATTTAGAGTTTTGGAGG + Intergenic
980173907 4:129322248-129322270 AATTAGGTCTATAATTTGGGAGG - Intergenic
980782547 4:137510313-137510335 TATCATGTTAAGCAATTGGGTGG - Intergenic
980819218 4:137991576-137991598 TATCAGGCTTACTATTTGAGTGG - Intergenic
982061858 4:151612770-151612792 TCTCAGGCTTAAATTTTGGGTGG + Intronic
984383708 4:179029222-179029244 GATAAGGATTAGAATCTGGGAGG + Intergenic
986840158 5:11687452-11687474 CAGCAGGTTTTGAATCTGGGTGG - Intronic
990342972 5:54842624-54842646 TATCAGGAATAGACTCTGGGAGG + Intergenic
992436220 5:76758410-76758432 TATCAGGGCCAGAATTTAGGGGG + Intergenic
993460909 5:88179981-88180003 TAACATGTATGGAATTTGGGGGG + Intergenic
993876488 5:93313462-93313484 TTTCAGATTTTGAATTTTGGGGG + Intergenic
994254215 5:97573616-97573638 TTTCAGTTTTAAAATTGGGGCGG + Intergenic
994994917 5:107048658-107048680 TGTCAGGTGTAGAATTTTAGTGG - Intergenic
995682225 5:114732501-114732523 TATTAGATTTATTATTTGGGGGG - Intergenic
996224575 5:120975875-120975897 TATCATGTTAAGTATCTGGGAGG - Intergenic
996648379 5:125843686-125843708 TATCAGCTTTAAAATTTTGGGGG - Intergenic
997397025 5:133569911-133569933 TATCAGATTTAGAAATTGCCCGG + Intronic
999962980 5:156776721-156776743 TATGATTTTAAGAATTTGGGTGG - Intergenic
1002567043 5:180118109-180118131 TATTACGTTTAGAATCAGGGAGG + Intronic
1007896227 6:45362116-45362138 TACCATATTTTGAATTTGGGTGG - Intronic
1011083523 6:83513941-83513963 GATCAGACTCAGAATTTGGGAGG + Intronic
1012033724 6:94104792-94104814 TATAAGGGTTGGAGTTTGGGTGG + Intergenic
1014788725 6:125646597-125646619 TATCAGCTTTAGAATTTTGGGGG - Intergenic
1018487112 6:164252069-164252091 CATCTGCTTTAGAATTTGGGGGG + Intergenic
1021098345 7:16559065-16559087 TATCAAGTTTAAAATTAGAGAGG + Intronic
1021118402 7:16769946-16769968 TATCAGTTTAAAAATTTGGAAGG + Intronic
1022942069 7:35250544-35250566 TACGAAGTCTAGAATTTGGGAGG - Intronic
1027660279 7:80980637-80980659 TATCAGAGTTTGAATTTGGCAGG - Intergenic
1027742813 7:82033653-82033675 TTTCAGGATTAGAATATGTGTGG - Intronic
1030439508 7:109570050-109570072 TATCTGGTTAAGGAGTTGGGAGG - Intergenic
1030777063 7:113547156-113547178 GGTCAGTTTTAGAATTTGGTGGG + Intergenic
1031448912 7:121890004-121890026 TACAATGTTTAGAAGTTGGGGGG - Intronic
1031849841 7:126850540-126850562 TACAAGGTTTAGGATTTGGTTGG + Intronic
1032600503 7:133288762-133288784 AACCAGGATTAGAATTTTGGAGG + Intronic
1034786115 7:153927415-153927437 TATCAGCTTTAATATTTTGGTGG + Intronic
1035184517 7:157115726-157115748 TTTTAGGTTTACACTTTGGGAGG + Intergenic
1035645115 8:1213028-1213050 TCTCATGATGAGAATTTGGGAGG + Intergenic
1040082558 8:43302876-43302898 CATCAGGTTTTGAATGTGGGTGG - Intergenic
1040408428 8:47132365-47132387 CATCAGGTTTTGAATGTGGGGGG + Intergenic
1042517459 8:69674493-69674515 TTTCTGCTTCAGAATTTGGGGGG + Intronic
1045109716 8:98928851-98928873 TAACAGGTTTAGAATGAGGGGGG + Intronic
1045736777 8:105305504-105305526 AATAAGATTTAGAATTTGGCAGG + Intronic
1047828222 8:128602342-128602364 TATTTGTTTTAGAAGTTGGGTGG - Intergenic
1049133160 8:140867535-140867557 GATCATGTTAAGAATTTTGGTGG + Intronic
1050330189 9:4537794-4537816 TAACAGGTGTGGAATTTTGGGGG + Intronic
1051777202 9:20648397-20648419 TATAAGCTTTAGAATTTGATTGG - Intergenic
1051828697 9:21251533-21251555 CAGCAGCTTTAGAATTTGGAAGG - Intergenic
1052158727 9:25227812-25227834 TTTCAGGTTTATGATTTGTGAGG + Intergenic
1056683299 9:88738780-88738802 TAAGTGGTTTAGAATTAGGGCGG - Intergenic
1186020967 X:5254771-5254793 TTTCAGGTTTTGGATTTGGATGG + Intergenic
1188559296 X:31449896-31449918 TAGCAGGTTAAGATTTTAGGAGG - Intronic
1189717210 X:43879050-43879072 TCTCAGTTTTAGTGTTTGGGTGG - Intronic
1190471447 X:50783870-50783892 TATAAAGTTTAGAATCTGGCCGG - Intronic
1192330774 X:70173548-70173570 TAACAGGTTGAGAAGTGGGGAGG - Intergenic
1193410766 X:81160167-81160189 TAGCAGGTTTAGGATTTGTTGGG + Intronic
1194005674 X:88488491-88488513 TATCAGCTTAAGTATTTTGGGGG + Intergenic
1194597097 X:95871878-95871900 TATCAGTTTTAGGAGTTTGGGGG - Intergenic
1194742095 X:97585821-97585843 TATCAGATTTAGAAATATGGAGG - Intronic
1196276213 X:113768153-113768175 CATCAGATTTTGGATTTGGGTGG + Intergenic
1196346994 X:114674545-114674567 TTTCATATTTACAATTTGGGAGG - Intronic
1196389831 X:115195817-115195839 AATCAGATTCAGGATTTGGGTGG - Intronic
1199137513 X:144270552-144270574 TACCAGGCTTAGTATCTGGGTGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic