ID: 1126834455

View in Genome Browser
Species Human (GRCh38)
Location 15:52645503-52645525
Sequence TGCTATGGGAATATTTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126834455 Original CRISPR TGCTATGGGAATATTTAGGA GGG Intronic
903764493 1:25725397-25725419 TGCTACGGGAATACAGAGGAAGG + Intronic
908803926 1:67910032-67910054 AGCTATGGGAATACTGAGAAAGG - Intergenic
909327305 1:74366899-74366921 TACTATGGGAATATATAATAAGG - Intronic
909328530 1:74383523-74383545 TGCTGTGGGAACGTGTAGGAGGG - Intronic
911203708 1:95071797-95071819 TGCTATGGCAGTCTTCAGGAAGG - Intronic
911654485 1:100427857-100427879 TGTTATGGGAATACTGAGGAAGG + Intronic
912651169 1:111440937-111440959 TGCTTAGGGAAGATGTAGGATGG + Exonic
917994035 1:180415890-180415912 TGCTATGTGAATTTTTTGGAGGG + Intronic
918585110 1:186177574-186177596 TGCTATGTGGAGAATTAGGAGGG + Intronic
919689265 1:200514705-200514727 TGCTGTAGGAAAATTTAGAAAGG - Intergenic
919909844 1:202104185-202104207 TCCTATGGGAGTGTATAGGAGGG + Intergenic
920076800 1:203343054-203343076 TGCTCTGGCAGTATTTAGAATGG - Intronic
920832208 1:209475667-209475689 TGCTATGGGAGCATGGAGGAGGG - Intergenic
921412130 1:214846794-214846816 TTCTATGGCAATATTGAGAAGGG - Intergenic
921488824 1:215748832-215748854 TGTTATGGGAATATATTGAAAGG - Intronic
923199724 1:231699629-231699651 GGCTATGGGAACATTCAGGAAGG - Intronic
923396430 1:233569328-233569350 AGCCATGTGAATATTTAGAAAGG - Intergenic
924120933 1:240797294-240797316 TGCTATGCAAACATTAAGGAGGG - Intronic
1063563248 10:7148786-7148808 TGCTAGAGGAATCTTTAAGATGG - Intergenic
1064202563 10:13297343-13297365 TTGTATGAGAATATTTAGGAAGG + Intronic
1066391696 10:34981992-34982014 TGCTATGAGCATATTTTGGGGGG + Intergenic
1067040760 10:42952030-42952052 GGCTCTGGGACTATTTAGGGAGG + Intergenic
1068171569 10:53401636-53401658 TGTTATGGGAATACTTATGTTGG - Intergenic
1069021323 10:63491711-63491733 TGTTATGGGAAGAACTAGGAGGG - Intergenic
1069395703 10:67985145-67985167 TGCTATGAGAACACTTGGGAGGG - Intronic
1074693879 10:116030401-116030423 TGCAATGGGAAGCATTAGGAGGG - Intergenic
1074727004 10:116321409-116321431 TGCTATGGGAATATAGGAGAGGG - Intergenic
1077663230 11:4087315-4087337 TGCTATGGGGGTGTTGAGGAAGG + Intronic
1078645466 11:13137948-13137970 TGCTATAGGAACATGGAGGAGGG + Intergenic
1079149163 11:17882510-17882532 TGCTGTGGGAATAGCCAGGACGG - Intronic
1080181803 11:29434435-29434457 GGCAATGAGAATATTTTGGAGGG - Intergenic
1080320738 11:31006354-31006376 CTCTATGGGAATCTATAGGAAGG - Intronic
1080390689 11:31843078-31843100 TGCTATGGGAGTATATACCAGGG - Intronic
1080658674 11:34278111-34278133 TGATATGTGAATATTAAGAAAGG - Intronic
1080730263 11:34943880-34943902 TGCTTTGGGAATGTTCAGGAGGG - Intronic
1082105636 11:48218247-48218269 TTATCAGGGAATATTTAGGAAGG + Intergenic
1082934032 11:58638230-58638252 TTCTATGGGAAAATGAAGGAGGG - Intergenic
1084811287 11:71613259-71613281 TGGTTTGGGAATAGGTAGGAGGG - Intergenic
1085553269 11:77395207-77395229 TGCTTTGGGAATATGGAGGAGGG - Intronic
1085724127 11:78939614-78939636 TGCTATGGGAACATAGAGAATGG - Intronic
1086282947 11:85212017-85212039 TGCAATGGGAATTTTGATGAGGG - Intronic
1087216092 11:95496629-95496651 TGCTCTGGGAGAATTAAGGAAGG + Intergenic
1088364307 11:109022765-109022787 TGATATGGGATTAGTTGGGATGG + Intergenic
1088564382 11:111152469-111152491 TGCTATGGGACTCTAGAGGAGGG + Intergenic
1089194214 11:116683194-116683216 GCTTATGGGAATCTTTAGGATGG - Intergenic
1090045456 11:123328281-123328303 TGCTATAGGAATATTTAGGCTGG + Intergenic
1093609734 12:21138860-21138882 TGCTATGGGTATATTGAGAATGG + Intronic
1094032797 12:26032498-26032520 TGACATGTGAATTTTTAGGAAGG + Intronic
1094216459 12:27947907-27947929 TGCTATGGGAACATGTAAGTGGG + Intergenic
1094784563 12:33831667-33831689 TACTATGGGAATAAGTAGGAAGG - Intergenic
1095533577 12:43220049-43220071 TGCTATGTAAATCTTCAGGAAGG - Intergenic
1096739807 12:53684766-53684788 TGCTATGGAAATACATAGGACGG + Intergenic
1096753633 12:53780690-53780712 TGCTATGAGAGGATATAGGAAGG + Intergenic
1098140447 12:67445331-67445353 TGCTATGGAAATACCTAGAAAGG + Intergenic
1098411975 12:70195928-70195950 GGCTATGGAAACATATAGGAAGG - Intergenic
1098560941 12:71871453-71871475 TATTATGGGAATAGTTAGAAAGG + Intronic
1098598987 12:72307107-72307129 TGCTATGGGAAGCCTTTGGAAGG + Intronic
1099783739 12:87234436-87234458 TACTATTTGAATATTTATGATGG - Intergenic
1099796415 12:87406480-87406502 TGCTATGGGAATATTTATCTAGG - Intergenic
1100038128 12:90278680-90278702 TCTTTGGGGAATATTTAGGAGGG + Intergenic
1100680303 12:96911754-96911776 CGCTATGGTAATATCTAGGTAGG + Intronic
1100851313 12:98714918-98714940 TGCAATGAGAATACTTAAGAGGG - Intronic
1100993287 12:100273759-100273781 TGCTATGGAAATATTAAGATGGG - Intronic
1102358472 12:112261319-112261341 TGCTATGTCACTATTTATGAGGG + Exonic
1106121961 13:26867431-26867453 CACTATGGGAATACTCAGGAAGG - Intergenic
1107431002 13:40340149-40340171 AGCTATGGGAGCAGTTAGGAGGG + Intergenic
1108029823 13:46218286-46218308 TGTATTGGGTATATTTAGGATGG + Intronic
1109119075 13:58430549-58430571 TGCTATCTGAATTTTTATGATGG + Intergenic
1109514172 13:63419649-63419671 TCCTTTGGGGATATTTAGAAAGG - Intergenic
1109875624 13:68400209-68400231 TGCTATGGGAAAATTTAAAAAGG + Intergenic
1109987895 13:70014442-70014464 TGCTATTGGAATACTTATTATGG - Intronic
1111895695 13:94138965-94138987 TGGTAAGGGAATAGATAGGAGGG + Intronic
1112424307 13:99283069-99283091 AGCTCAGAGAATATTTAGGAAGG + Intronic
1112622115 13:101063389-101063411 GGCTAGGGGAATAAATAGGAAGG + Intronic
1113007832 13:105727274-105727296 TGATACAGGAATATTTTGGATGG + Intergenic
1114351232 14:21853874-21853896 AGCTATTGGAATATTAAAGATGG + Intergenic
1115376782 14:32685312-32685334 TGTTATGGGAATACTGAGAAGGG + Intronic
1115378475 14:32705848-32705870 TAGTAAGGGAATATTTAAGACGG - Intronic
1117156647 14:52948942-52948964 TGGTATGAGATTATTTAAGAAGG - Intronic
1118456704 14:65951481-65951503 TGCTATGGAAATACAAAGGAAGG - Intergenic
1118851839 14:69590015-69590037 AGCTATGGGAAAATATATGAAGG - Intergenic
1119053419 14:71393114-71393136 TCCTATTGGAATATTTAATAAGG - Intronic
1119123870 14:72105772-72105794 TGCTATGGAACTATTTAGAAAGG - Intronic
1121812205 14:96901104-96901126 TGCTATGGGGATTTAGAGGAAGG - Intronic
1126434305 15:48620151-48620173 CACTATGGGAATTCTTAGGAAGG + Intronic
1126834455 15:52645503-52645525 TGCTATGGGAATATTTAGGAGGG + Intronic
1130037737 15:80377017-80377039 TGCTATGGGCATCTTGAGGAAGG + Exonic
1131237950 15:90713359-90713381 TGTTATGGGAAAACCTAGGAGGG + Intergenic
1133489203 16:6250611-6250633 TGCTCTGGGAAGATTTGAGAGGG + Intronic
1134781867 16:16905531-16905553 AGCTATGGGAATATCAAGGAGGG - Intergenic
1136495435 16:30640528-30640550 TGTTTTGTGAATTTTTAGGAGGG - Intergenic
1138038444 16:53632888-53632910 TGCTATGGGAGCATTCAGAAGGG - Intronic
1139483600 16:67244379-67244401 GGCTGGGGGAATATTTTGGAGGG + Intronic
1140979413 16:80092506-80092528 TGCAATGGGAACATCAAGGATGG - Intergenic
1142933329 17:3307137-3307159 TGCTATGGGAAGACAGAGGAAGG + Intergenic
1143690403 17:8558342-8558364 TGCTATGGGAACATAGAGAAAGG + Intronic
1144477780 17:15603667-15603689 TAGTATGGGAATTTCTAGGAAGG - Intronic
1144529391 17:16021493-16021515 TGCTATGTAGATATTTATGAAGG + Intronic
1144793197 17:17873374-17873396 TGCTTTGGGAGTCTTGAGGAGGG - Intronic
1144920515 17:18760016-18760038 TAGTATGGGAATTTCTAGGAAGG + Intronic
1146678434 17:34790005-34790027 TGCTGTGGGAATGTTTGGAAGGG - Intergenic
1149855298 17:60077839-60077861 CGCTATGGGAATAGACAGGAGGG + Intronic
1151428171 17:74044760-74044782 TGCTCTGTGAATATTAAGGAAGG + Intergenic
1151990658 17:77571931-77571953 TGCACAGTGAATATTTAGGAAGG + Intergenic
1152990085 18:355282-355304 TGCTATGGGAACAAACAGGAAGG + Intronic
1155423013 18:25675990-25676012 TGCTATGAGAGTATTTAACAGGG - Intergenic
1155999219 18:32366222-32366244 TGCTATGGGACTGTTTAGAAAGG - Intronic
1156062527 18:33097619-33097641 TGCGAAGGGAATATATTGGACGG - Intronic
1156507883 18:37610020-37610042 TGCAATGGGTATTTTTAGGAAGG + Intergenic
1156741452 18:40335038-40335060 TTGTATGGGAATATTTTGGTTGG + Intergenic
1157993492 18:52526308-52526330 TGCAATGAGAATATTGAGTATGG + Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1163174264 19:15552983-15553005 TGATATGGGAATATAAAAGATGG + Intergenic
1164724711 19:30458336-30458358 AGCCATGGAAACATTTAGGAAGG - Intronic
1166326338 19:42053421-42053443 TGCTCTGGCAGCATTTAGGATGG + Intronic
1166756642 19:45196504-45196526 TGCTAGGGGAATATTCCTGAGGG + Intronic
1167430728 19:49453046-49453068 TACTTTGCGAATAGTTAGGAGGG - Intronic
925128939 2:1480974-1480996 TGCTGTGGGCATGTTTGGGAGGG + Intronic
926841533 2:17086353-17086375 TGCTATGGAAATTTCCAGGAAGG + Intergenic
927570674 2:24156664-24156686 GTTTATGGGAATGTTTAGGAAGG - Intronic
928459261 2:31455488-31455510 TGCTATAGGTATATTTAAAAGGG - Intergenic
929061528 2:37929959-37929981 TATTATGTGAATATTGAGGAAGG + Intronic
930879995 2:56259686-56259708 GGCTCTGGGAAGATCTAGGAAGG - Intronic
931642908 2:64397041-64397063 TGCTATGGGAATTTGCATGAGGG - Intergenic
931869687 2:66444969-66444991 AGTTATGGGAATTTTTTGGAGGG + Intronic
940328402 2:152449854-152449876 TACTCTGGGAAAATGTAGGAAGG - Intronic
940754237 2:157663484-157663506 TGCTTTGGAAACATTTAAGAGGG + Intergenic
941953986 2:171185689-171185711 TGCTATGGGAGTACAAAGGAAGG - Intronic
942437145 2:175991534-175991556 TGCTATGGGAGCATTTAATAGGG - Intronic
942655925 2:178213959-178213981 TGCTGTTGGCATATTTAGTAGGG - Intronic
943199593 2:184803376-184803398 TGCTATGTGAATATAAAGGAAGG - Intronic
943377706 2:187100313-187100335 TGTTATAGGAACATTTAAGAGGG - Intergenic
943533727 2:189121098-189121120 TGTTGTGGGAACATGTAGGAAGG + Intronic
944005288 2:194897166-194897188 TGCTGCTGGAATATTGAGGAGGG + Intergenic
944617205 2:201473693-201473715 CCCTATGTGACTATTTAGGATGG - Intronic
944673831 2:202018509-202018531 TGCATTGGAAATATTCAGGATGG + Intergenic
944911745 2:204317406-204317428 TGCTATGGGAACACAGAGGAGGG + Intergenic
945769829 2:214029404-214029426 TGGTATGGGAAGATATTGGAGGG + Intronic
948629918 2:239295524-239295546 TGCTCTGGGAAGTTTTAGAAAGG - Intronic
1169483600 20:6006906-6006928 GTCTTTGGGAATATTTAGAAAGG + Intronic
1179262324 21:39768784-39768806 TTCCAAGGGAATATTCAGGAAGG + Intronic
1180634772 22:17255492-17255514 TCCTATGGGATTATTTAGTGAGG - Intergenic
1184578056 22:45390368-45390390 TGCTCTGAGAATATTTAACAGGG + Intronic
949432161 3:3989413-3989435 TGCTATGGGAACATAGAAGAGGG + Intronic
949610406 3:5698297-5698319 TGCTGTAGGAATATTTTGGCTGG + Intergenic
950813490 3:15673212-15673234 TGCTATGAGAGTACTTAAGAGGG - Intronic
952280670 3:31920179-31920201 AGCATTGGGAATTTTTAGGATGG + Intronic
952880457 3:37982619-37982641 TGCTGTGTGAATATTCAGAAGGG + Exonic
955658198 3:61267287-61267309 TGCTATGGGTAGATCTAGTATGG - Intergenic
955662792 3:61319158-61319180 TGCTATGGGACAGTTAAGGAGGG - Intergenic
955851383 3:63223735-63223757 TGCTATGGGAATATAGAAGAGGG - Intergenic
958057877 3:88436684-88436706 TGCTATCTGATTATTCAGGAAGG + Intergenic
958917736 3:100068501-100068523 TGCTATAGGAATATTAATGTTGG + Intronic
959079421 3:101784340-101784362 TGCTATGGGAACTCTGAGGATGG + Intronic
960513849 3:118581181-118581203 AGCTATAGGAAGATTAAGGAGGG - Intergenic
966129504 3:176621520-176621542 TGTTATGGATATATTTAGAAAGG + Intergenic
966599411 3:181760624-181760646 TGTTGTGGGAACAATTAGGAGGG + Intergenic
966601341 3:181778278-181778300 TGCTATGGGAACATAGAGGAAGG - Intergenic
967039969 3:185682863-185682885 TGCTATGGGAAAAAGTATGAAGG + Intronic
970240643 4:14005161-14005183 TGCAATGGGATTAAGTAGGAGGG + Intergenic
971610155 4:28713807-28713829 TGCTCTGGGAAAATTTAACAGGG + Intergenic
972438431 4:39058943-39058965 TGCTATGAAAAAAATTAGGAGGG + Intronic
972706857 4:41553326-41553348 TGCTGTGGGAACATAGAGGAGGG + Intronic
973222334 4:47742605-47742627 TACTATGGTAATATTTAAGTAGG - Intronic
973934399 4:55828409-55828431 TGCTATGGGAATCAAGAGGATGG - Intergenic
976430506 4:84958526-84958548 TGCTAAGGGAACATCCAGGAGGG + Intronic
978214610 4:106183983-106184005 TGCTCTTGGCATATTTAGAATGG - Intronic
979573560 4:122258928-122258950 TGCTATCTGAATATTTAGGGTGG - Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
983159929 4:164399871-164399893 TGCTATAGGAATCTAGAGGAGGG - Intergenic
983716812 4:170791572-170791594 TTCTCTTGAAATATTTAGGAGGG - Intergenic
987181332 5:15371740-15371762 TGCTATGGGAATTTAAAGGAGGG - Intergenic
987445458 5:18012875-18012897 TGATATGGATATATTTAGGTTGG + Intergenic
988277977 5:29107498-29107520 GGTTAAGGGAATATTAAGGACGG + Intergenic
988696803 5:33629813-33629835 AACTATGTGCATATTTAGGAAGG - Intronic
989518997 5:42378631-42378653 TACTATTGGCATATTTGGGAAGG + Intergenic
989689855 5:44128796-44128818 TGTTAGTGGAAGATTTAGGATGG + Intergenic
990638752 5:57759056-57759078 GGCTATTGGAATGTTTAGGCTGG + Intergenic
990836392 5:60026205-60026227 TCCCATGGAAATATTTAGCAAGG - Intronic
990846793 5:60149736-60149758 TGCTATGAGAATGCATAGGAAGG - Intronic
990907914 5:60823347-60823369 TGCTATGGGCGCATGTAGGAAGG - Intronic
995843550 5:116468137-116468159 TGCCATGGGAATATCAAAGAAGG - Intronic
996643410 5:125786352-125786374 TGCTATGGATGTATTTAGAATGG + Intergenic
998918988 5:147046932-147046954 TAATATGGGAAGATTTAAGATGG + Intronic
1000323636 5:160155337-160155359 TGTTTTGGGAATATCTAAGAGGG - Intergenic
1001855247 5:175005007-175005029 AGCTTTGAGAATTTTTAGGATGG + Intergenic
1003369781 6:5513072-5513094 GGCTATGGGAATATTTCCTAGGG + Intronic
1004010365 6:11680364-11680386 TGCTATGAGAACATTTAGAAAGG + Intergenic
1004637730 6:17485190-17485212 TTTTATGTGAATATTTATGAGGG + Intronic
1004683695 6:17921193-17921215 TGCTTTGGGAATTTTTAAGTTGG - Intronic
1004886995 6:20060711-20060733 TGCCATGAGAACACTTAGGAGGG + Intergenic
1005336827 6:24805340-24805362 TGATTTGGGAATTTTCAGGATGG + Exonic
1007463966 6:42038897-42038919 TGCTGTGGGAATCTGGAGGAAGG - Intronic
1008517966 6:52335987-52336009 TGCTGTGGGAAGATGGAGGAAGG - Intergenic
1008708866 6:54198994-54199016 TGTTCTGAGAATATTTAGGATGG + Intronic
1008756784 6:54805407-54805429 TGGGAAGTGAATATTTAGGAAGG + Intergenic
1011535587 6:88372533-88372555 TGCTATGGGACTGTTTTAGAGGG + Intergenic
1011790087 6:90889498-90889520 TGATATGGGAGTGTGTAGGAAGG + Intergenic
1012046900 6:94287610-94287632 TGCTTTCCAAATATTTAGGATGG + Intergenic
1014190457 6:118489714-118489736 TGCTATGGGAATCTGTATGGAGG + Intronic
1015120789 6:129699225-129699247 TGATTTGGGAGTATTTAGGAAGG - Intronic
1015428688 6:133103692-133103714 TGACATGGGAACATTTGGGAGGG + Intergenic
1016607246 6:145944403-145944425 TGCTATGGGAATACCTAAGAGGG + Intronic
1018362513 6:163086466-163086488 TTCTATGGTTATATTTAGGTTGG + Intronic
1019074921 6:169379412-169379434 TGCTGGGGGAAGATTTGGGAGGG - Intergenic
1022278884 7:28885168-28885190 TGCTATGGGAATACAAAAGAAGG + Intergenic
1023770562 7:43553110-43553132 TGCAAGGTGAGTATTTAGGAAGG - Intronic
1024706716 7:51969529-51969551 TGCTGGGAGAATACTTAGGAAGG + Intergenic
1026576896 7:71579482-71579504 TGCTGTGGGAAAATATAGTAAGG + Intronic
1030268494 7:107645712-107645734 TGCTAAGGTTATATGTAGGAAGG + Intergenic
1031024211 7:116662708-116662730 TGCCATGCAAATATTTAAGAAGG + Intergenic
1031614408 7:123864317-123864339 TGTTCTGGGAATATATAGGAAGG - Intronic
1033355330 7:140594516-140594538 TGCCATGGGAACATTCAGCAGGG - Intronic
1034596052 7:152193237-152193259 AGGTATGGGAATCTATAGGAAGG - Intronic
1036375507 8:8196074-8196096 TGCTAGGGGCAGATTAAGGAAGG - Intergenic
1036854026 8:12227075-12227097 TGCTAGGGGCAGATTAAGGAAGG + Intergenic
1036875398 8:12469573-12469595 TGCTAGGGGCAGATTAAGGAAGG + Intergenic
1037011566 8:13850032-13850054 TGCTTTGGGAAGGTTTATGAGGG + Intergenic
1039182134 8:34878633-34878655 TCCTATGGGATTAGTTAGGGGGG - Intergenic
1039687555 8:39821432-39821454 TGGTATGGAAATACTTATGATGG - Intronic
1039759295 8:40557613-40557635 TGCTATGGGAATATAAAAGAGGG - Intronic
1040049740 8:43001609-43001631 TGGTATGGGAATGTGAAGGATGG - Intronic
1040868928 8:52079894-52079916 TGCAATGGGAAGATTTTGAAGGG + Intergenic
1041597493 8:59673148-59673170 TGCTATAGGAATAGTTAAAAAGG + Intergenic
1043196507 8:77299489-77299511 TCCTATGAAAATATTTAGGGAGG + Intergenic
1043218516 8:77627607-77627629 TGCAATGGGATTAGTTTGGAAGG - Intergenic
1044742306 8:95340696-95340718 TGATCTGGAAATATTTAGCAAGG - Intergenic
1045015134 8:97994869-97994891 TGCTATGGGAATAAGGGGGAGGG - Intronic
1045747216 8:105437705-105437727 TCCTATGGGACTCTTTGGGAAGG + Intronic
1046372858 8:113333701-113333723 TACTGTGGGAAGATTTAGTATGG - Intronic
1048813717 8:138311407-138311429 TGCTATGTTAAAATTAAGGAAGG - Intronic
1049544951 8:143226197-143226219 TGCTTTGGGAATATGTATGAAGG + Intergenic
1051560429 9:18435489-18435511 TACTATGAGAATATATAGGAGGG + Intergenic
1054825172 9:69566175-69566197 TGCTATGGGGATATGCAGCACGG - Intronic
1055024369 9:71703679-71703701 TGGGATGGGACTATTTAGAAAGG - Intronic
1055087158 9:72326007-72326029 TGGGATGGGAAAATTTAGGTGGG + Intergenic
1055416959 9:76093907-76093929 TGCTATGACAATCTCTAGGAGGG - Intronic
1055946506 9:81695960-81695982 TGTTATGTGAATATGTAGGAAGG - Intergenic
1056034438 9:82588588-82588610 TCATATGGGAAGATTTATGAAGG - Intergenic
1061386946 9:130295984-130296006 TACTTTGGGAACATTTAAGAAGG + Intronic
1203768043 EBV:36602-36624 TGCTATGCGAATGCTTTGGATGG + Intergenic
1186750336 X:12614965-12614987 TCCTGTGGGACAATTTAGGATGG + Intronic
1186909554 X:14147633-14147655 TGTTATGAGAATATAGAGGATGG - Intergenic
1186977000 X:14918099-14918121 GGTTATGGGAATATTTTGAAAGG + Intronic
1187107630 X:16260616-16260638 TGCTATGGGAATGTGGAGAAGGG + Intergenic
1187536770 X:20148064-20148086 TGCTGTAGGAATATGTAGCAGGG - Intergenic
1189843598 X:45109220-45109242 GGCAATGGGAATATTAAAGAAGG + Intronic
1190126633 X:47711409-47711431 TGCTGTGGGAAAACTGAGGAAGG + Intergenic
1193195819 X:78630741-78630763 TGCTATGTGAATATTAAAAAAGG + Intergenic
1194570767 X:95551894-95551916 TGGAATGGGGATATATAGGATGG - Intergenic
1195277323 X:103294411-103294433 TACTATGGGAATTTTTTTGAGGG + Intergenic
1197853970 X:130895003-130895025 TGTTCTGGGAATATGGAGGAGGG - Intronic
1198497703 X:137209691-137209713 TGCAGTGGCAATATTTTGGAAGG - Intergenic
1199084504 X:143613142-143613164 TACTATGGGGATATATAGGTGGG + Intergenic
1201855173 Y:18533875-18533897 TGATATGGTAATACTAAGGATGG + Intergenic
1201878148 Y:18786509-18786531 TGATATGGTAATACTAAGGATGG - Intronic