ID: 1126837961

View in Genome Browser
Species Human (GRCh38)
Location 15:52686888-52686910
Sequence CTGTGCAAGTTGAAATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126837961_1126837963 10 Left 1126837961 15:52686888-52686910 CCTTCTTATTTCAACTTGCACAG 0: 1
1: 0
2: 1
3: 20
4: 207
Right 1126837963 15:52686921-52686943 TACCTGCAACTCAAAATAATTGG 0: 1
1: 0
2: 0
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126837961 Original CRISPR CTGTGCAAGTTGAAATAAGA AGG (reversed) Intronic
903473301 1:23602415-23602437 CTGTGCAGGGTGGAAGAAGAGGG - Intronic
904087932 1:27923053-27923075 CAGTCCCAGTTGAACTAAGACGG + Intergenic
907008116 1:50936090-50936112 TTGAGCTTGTTGAAATAAGAAGG - Intronic
907286701 1:53385034-53385056 CTGAGCAAGTGGAAAACAGAAGG - Intergenic
908236763 1:62154690-62154712 CTTTGAAAGGAGAAATAAGAAGG + Intronic
909017635 1:70397128-70397150 ATGTGCAAGGTGAACTAACAAGG + Intergenic
909281681 1:73763340-73763362 CTGAGCTAGCTGTAATAAGAAGG - Intergenic
911485027 1:98494699-98494721 ATATGCTAGTTGAAATTAGATGG + Intergenic
911671517 1:100613745-100613767 CTCCTCAAGTTGAATTAAGAAGG + Intergenic
912797003 1:112699494-112699516 CTGTGGAAGCTGAAACATGAAGG - Intronic
916900049 1:169212554-169212576 GTGTGAGAGTTAAAATAAGAAGG - Intronic
917156868 1:172011804-172011826 TTTTGCAAGTGGAAATAAAAAGG - Intronic
917341053 1:173977991-173978013 AAGTGCAAGTTGAAAAATGAAGG + Intronic
918364238 1:183789731-183789753 CTATGCCAGTTTAAACAAGAAGG + Intronic
918494616 1:185120413-185120435 CTGTGAATGTTGTAATAAAAGGG + Exonic
920707739 1:208266806-208266828 TTGTCCAAGTTGAGAGAAGATGG - Intergenic
920915544 1:210255233-210255255 CTGGGCAACTTAAAACAAGAAGG - Intergenic
921019136 1:211220569-211220591 CTGAGCAAGTGGAAACATGAAGG - Intergenic
921712740 1:218388872-218388894 CTCTTCAAGTTGGAATATGATGG + Intronic
922184802 1:223264819-223264841 CTGTGGAAGGTGAAAGAAAAAGG + Intronic
923961454 1:239088752-239088774 ATGGGAAAGTTGAAAAAAGAAGG - Intergenic
1064016454 10:11776425-11776447 CTCTGTAAGTTGAAACAAAATGG + Intergenic
1064803139 10:19099076-19099098 CTGTGCATGTGGTAATAAAAGGG + Intronic
1066002045 10:31113869-31113891 CTGTGCCTGTTGAACAAAGAAGG + Intergenic
1066102324 10:32128561-32128583 CTGTGCAAGATGCAATAGAAAGG - Intergenic
1066588827 10:36969719-36969741 CTGTGCAATTTTAATTAAAAGGG - Intergenic
1070374793 10:75819069-75819091 TTGTGTAAGTTGAAAACAGAGGG + Intronic
1070546409 10:77456317-77456339 CTGTGCAAGCTGACATGAGAAGG - Intronic
1075740733 10:124694479-124694501 CTGTGTAAGTTATAATAAGGTGG - Intronic
1076393278 10:130119854-130119876 CTGGGAATGTTTAAATAAGAGGG - Intergenic
1076661945 10:132061522-132061544 CTTGGCAAGTTGATATAAAAAGG + Intergenic
1079877731 11:25880856-25880878 TTGTGCTAGTTGCAATAAGATGG - Intergenic
1080236743 11:30078649-30078671 CTGCTCAAGTGGAAATAAGTTGG - Intergenic
1081741818 11:45446269-45446291 TTGTGCAAATTTAAAAAAGATGG + Intergenic
1085260613 11:75202718-75202740 CTCTGCAGGTTGAAAAAGGATGG + Intronic
1086339628 11:85835509-85835531 CTGTGCAACTGAAAATAACAAGG - Intergenic
1087167128 11:95016187-95016209 TTGAGCAAGTTTAGATAAGAGGG + Intergenic
1087167191 11:95016681-95016703 GTGTTCAACTTGAAATGAGAAGG + Intergenic
1089697009 11:120222084-120222106 CTGTGAAGGTTGGAAGAAGAGGG + Intronic
1094561939 12:31563135-31563157 CTTTGCAAGGTGAAAAAACATGG - Intronic
1097638715 12:62153101-62153123 ATTTGCAAGTTGAAAGCAGAAGG + Intronic
1098778116 12:74648613-74648635 ATATGAAAGCTGAAATAAGATGG - Intergenic
1099420204 12:82448721-82448743 GTGGTCAAGTTGAAATTAGAAGG + Intronic
1100137846 12:91576283-91576305 GTATGGAAGCTGAAATAAGAGGG - Intergenic
1100385202 12:94099666-94099688 GTGTGCAAGTTGCAGAAAGAAGG + Intergenic
1101906240 12:108828647-108828669 CTGCCCAAGTAGAAATCAGAAGG + Intronic
1102631552 12:114285246-114285268 TTTTGCAGTTTGAAATAAGAAGG - Intergenic
1104342623 12:127965884-127965906 CTGGCCAAGATGAACTAAGAGGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105813194 13:24011898-24011920 CGCTGCAAGTTTAAAGAAGAAGG - Intronic
1106120736 13:26858247-26858269 CTGAGAAACTTGAAATAGGAGGG - Intergenic
1106268909 13:28135634-28135656 CTGTGCAGGTTGGCATAAAATGG + Intergenic
1106863148 13:33933653-33933675 CTGTGAAATTGAAAATAAGAAGG + Intronic
1107868238 13:44724476-44724498 GTGTCCAAGATAAAATAAGAAGG + Intergenic
1108224014 13:48269130-48269152 CTGTGCAACTGGAAAAAAAAAGG - Exonic
1108828202 13:54441769-54441791 ATGTGCAATTTTAAATGAGATGG + Intergenic
1109728786 13:66382436-66382458 GTGTCCTATTTGAAATAAGAAGG + Intronic
1109992566 13:70078243-70078265 CTGTGAATGTTGTAATAAGAAGG - Intronic
1110531161 13:76600630-76600652 ATGTGCAAATTGAAATTATAAGG - Intergenic
1110787701 13:79550994-79551016 CTGAGAAGGTTGAAATAATATGG - Intronic
1111670384 13:91322206-91322228 CAGTGCAAGTGGAAAGAAAAAGG + Intergenic
1114300941 14:21377282-21377304 CTGTGCAATTTCAAAACAGAAGG + Intronic
1114709908 14:24767765-24767787 TTGTGTAAGTTGAAATAAATTGG + Intergenic
1114730469 14:24987582-24987604 GTGTGGAAGATGAAATAGGATGG - Intronic
1116787732 14:49306463-49306485 CAGTGCAACCTGAAATCAGAGGG - Intergenic
1118270316 14:64337422-64337444 CTGAGCAAGTGAAATTAAGAAGG - Intronic
1120520130 14:85517634-85517656 CTCTGCAGGTTGAATTTAGAAGG - Intergenic
1122095064 14:99364440-99364462 CTCTGCAAGTTGAAGGAAAAGGG + Intergenic
1123217204 14:106822403-106822425 CAGTTAAAGTTAAAATAAGAAGG + Intergenic
1125554169 15:40570278-40570300 CTGTGCAAATAGTAATAATAGGG + Intronic
1126837961 15:52686888-52686910 CTGTGCAAGTTGAAATAAGAAGG - Intronic
1130416562 15:83699871-83699893 CTGTTCAATTTTAGATAAGATGG - Intronic
1130974605 15:88763730-88763752 CTGTGCACTATGAAATAATATGG + Intergenic
1140229591 16:73106643-73106665 CTGTGCAAGTTGGAAAAAGCTGG + Intergenic
1141395071 16:83697273-83697295 CTATGAGAGCTGAAATAAGAAGG - Intronic
1141571668 16:84937912-84937934 CTGTGCAAGAAAAAATAAAATGG - Intergenic
1143788316 17:9273399-9273421 CTCTGCAGGTTTAACTAAGATGG + Intronic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1146809338 17:35890757-35890779 CAGTGCAAGGTGACAGAAGAGGG - Intergenic
1147941219 17:44049710-44049732 CTGGGCATGTGGAAATAAGATGG - Intronic
1151073864 17:71248725-71248747 CTGTGTAAGTTGAAATAGAAGGG + Intergenic
1155416114 18:25601521-25601543 TTGTGCAAGATGAAAATAGATGG - Intergenic
1155936031 18:31755171-31755193 ATGTGAAAGGTGAAATAAAAAGG + Intergenic
1156652494 18:39240713-39240735 TTGTGCAAGTTGTAAGAAAAGGG - Intergenic
1157116517 18:44867417-44867439 GTGGGCTTGTTGAAATAAGATGG - Intronic
1158957787 18:62557156-62557178 TGGTGAAAGGTGAAATAAGAGGG - Intronic
1159285947 18:66351892-66351914 CTGTACTAGCTGAAATATGAGGG + Intergenic
1159762533 18:72446077-72446099 ATGTGCAAACTGAAATAAAAAGG - Intergenic
1159836808 18:73346556-73346578 CTGTGCAACATGAAATGAGCAGG + Intergenic
1163198191 19:15740896-15740918 ATGTGTAATTTGAAATAAGATGG + Intergenic
1167173558 19:47849812-47849834 CTGTGCAATTTGCAATACAAAGG + Intergenic
925021823 2:575660-575682 CAGTGAAAGTGGAAATAACAAGG + Intergenic
925640753 2:5984051-5984073 CTGTGCAACTTGAATTAGGCTGG + Intergenic
926561644 2:14424281-14424303 CTGTGCAAGATGAACTAATCTGG + Intergenic
926812662 2:16770346-16770368 GTTTGAAAGCTGAAATAAGAAGG + Intergenic
928270293 2:29849372-29849394 CTGTGCATGTGGTAAGAAGAGGG + Intronic
928849457 2:35726961-35726983 CTGTGCAGGTTAATATGAGATGG - Intergenic
930489391 2:52049117-52049139 TTTTTCAAGTTTAAATAAGAGGG + Intergenic
931057115 2:58484929-58484951 ATGTGCAAATTTTAATAAGAGGG - Intergenic
931998903 2:67865806-67865828 CTGTGCACGCTCAAAGAAGAGGG + Intergenic
932688786 2:73895025-73895047 CCGTGCAGGTAGAAGTAAGAAGG + Intronic
933466851 2:82662543-82662565 CTGTGCAAATTTAAGTAATAAGG - Intergenic
933867519 2:86535417-86535439 CTGTACAAAAGGAAATAAGAAGG - Intronic
935020214 2:99223065-99223087 CTGTGTAAGTAAAAATAGGATGG - Intronic
935493931 2:103754861-103754883 CTCTGCAACTTGGAGTAAGAGGG - Intergenic
935685650 2:105680420-105680442 TGGTGCAATTTTAAATAAGATGG + Intergenic
936039771 2:109141353-109141375 CTGAGCAAGTTGGAGGAAGAGGG - Intronic
936747801 2:115600830-115600852 TTGTGCAAATTTAAATTAGATGG - Intronic
936773174 2:115939395-115939417 CTGGGATAGTAGAAATAAGAAGG - Intergenic
937547869 2:123046536-123046558 GTGTGAAAGCTGAAATAAGAAGG - Intergenic
937713742 2:125008760-125008782 GTGTGCAATTTAAAATAGGATGG + Intergenic
938614260 2:132981114-132981136 CTGTACATTTTGTAATAAGAAGG + Intronic
939546419 2:143559914-143559936 ATGTGCAAGGTGAATAAAGAAGG - Intronic
941012894 2:160321287-160321309 CTGTGAAAGATGGAATGAGATGG - Intronic
941281020 2:163550703-163550725 ATGTGGAACTTGAACTAAGAGGG + Intergenic
942334040 2:174861776-174861798 ATGTGCCACCTGAAATAAGAAGG + Intronic
943046156 2:182864782-182864804 CTGCGCAAGTTGAAAGAGGAAGG + Intronic
943799321 2:192038032-192038054 TTGTGAAAGATTAAATAAGATGG + Intronic
945218392 2:207459681-207459703 CCCTGCAAGGTGAAATTAGATGG + Intergenic
945648507 2:212531635-212531657 CTATGAATGCTGAAATAAGATGG - Intronic
945909898 2:215636443-215636465 CTGTGGAAGGTGAAATGAGTGGG - Intergenic
945913629 2:215679329-215679351 CTGTGCTAAGTGAAATAAGCTGG + Intergenic
946634239 2:221706985-221707007 CTGTCCTATTTGAAATGAGACGG + Intergenic
946973408 2:225120919-225120941 CAGTACTATTTGAAATAAGAAGG - Intergenic
1170812384 20:19684620-19684642 CTGTGCAAGTTCATATCAGGGGG - Intronic
1171195837 20:23198591-23198613 CTGTGCAAGATGGAGTAACAGGG - Intergenic
1173962021 20:47081476-47081498 CTGTGAAAATTGAAATAAAAAGG + Intronic
954841345 3:53514555-53514577 CTGTGGAAGAGGAAATAAAATGG + Intronic
958120002 3:89273988-89274010 GTGTGAGAGTTGAAATAAGAAGG + Intronic
959389115 3:105751619-105751641 CTGTGCAAGGTGGAAAAAAAGGG + Intronic
959774568 3:110141451-110141473 CTGTGCAATTGTAAATAAAACGG - Intergenic
960089956 3:113628840-113628862 CTGTGCACTTTGCAAGAAGAGGG - Exonic
960851454 3:122059146-122059168 AGGTGCAAGTTCAAAAAAGAGGG + Intronic
961477372 3:127157278-127157300 CTGTGCAAGCTGAAATTGTATGG + Intergenic
962595462 3:136938464-136938486 GTATGAAAGCTGAAATAAGAAGG - Intronic
964097569 3:152951026-152951048 CTGTTCAAATTGAAATAAACTGG - Intergenic
970262159 4:14237614-14237636 CTGGGCAAGTTGGAATGGGATGG + Intergenic
970325836 4:14924922-14924944 CTATGATAGATGAAATAAGAAGG + Intergenic
970403679 4:15742010-15742032 CTGAGCATGTTAAAATAAAATGG - Intergenic
971740356 4:30511891-30511913 CTGGGGAAGTTAAAATAAGGAGG - Intergenic
971780126 4:31022855-31022877 CTGTGCAAGGTAGAATAATACGG + Intronic
972802569 4:42492522-42492544 CTGTGCATGATGGAAGAAGAAGG - Intronic
973031289 4:45344196-45344218 ATTTTAAAGTTGAAATAAGATGG + Intergenic
974429888 4:61782189-61782211 CTGTGCACATTAAAATAACAGGG - Intronic
977804875 4:101285481-101285503 TTGTGCAATGTGATATAAGAAGG - Intronic
978163902 4:105583551-105583573 GTGTGCAATTTTAAATAAGATGG - Intronic
978765793 4:112403724-112403746 TAGTGCAAGTGGAAATAATAGGG + Intronic
978967973 4:114766076-114766098 TTGGGCAAATTGAAATAAGTTGG + Intergenic
979418403 4:120472567-120472589 ATGTGCATGTTGAAATATGTAGG + Intergenic
980329810 4:131395941-131395963 TTCTGCAAGTGTAAATAAGAGGG - Intergenic
981301313 4:143189092-143189114 GTTTGCAATTTTAAATAAGATGG + Intronic
981766231 4:148253412-148253434 GTGTGCAAGTTGGAAATAGAAGG + Intronic
981828443 4:148972444-148972466 ATGTGCAATTTTAAATTAGATGG + Intergenic
982936145 4:161478650-161478672 GTATGAAAGTTGAAACAAGAAGG + Intronic
983252517 4:165360785-165360807 CTGTGCAAGTTCATATAAATAGG - Intergenic
983878962 4:172911576-172911598 CTGGGCATGTTGAACTAAAATGG - Intronic
984233149 4:177124260-177124282 CTCTCCATTTTGAAATAAGAAGG + Intergenic
984277245 4:177625949-177625971 TTGTGCAAGGATAAATAAGAAGG - Intergenic
986975713 5:13391077-13391099 CCTTGAAAGATGAAATAAGAAGG - Intergenic
987295943 5:16551491-16551513 CTGGGCAAGTAGAAATAAGAAGG - Intronic
989233123 5:39110124-39110146 CTGTACAATTTTAAATGAGAAGG + Intronic
991628715 5:68632175-68632197 CTGTTCAAATAAAAATAAGATGG + Intergenic
993092488 5:83443267-83443289 CTGATCAAGATGAAATAAAATGG + Intergenic
993651528 5:90528901-90528923 CTAAGCAAGGTGCAATAAGAGGG + Intronic
994792991 5:104256215-104256237 TTCTTCAAGTTGAAATAAAAGGG - Intergenic
995167341 5:109059600-109059622 CATTACATGTTGAAATAAGAGGG - Intronic
997523943 5:134540705-134540727 CTGTTCAAGTTGAAGTGGGATGG + Intronic
999610842 5:153367841-153367863 CTATGGAACTTGAAAGAAGAAGG - Intergenic
1000776942 5:165431654-165431676 CTGTTCAAGTTAAAATTAAAGGG - Intergenic
1003219073 6:4141091-4141113 GTATGACAGTTGAAATAAGAAGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1006549288 6:34807578-34807600 CTGGGCCAGTTGAAAGAACAAGG - Intronic
1008269823 6:49478070-49478092 CTGTGAAAGTAAAAATAAGGAGG - Intronic
1008401674 6:51070333-51070355 CTGTTCAAGATGAAAGAAAAAGG - Intergenic
1009894492 6:69731095-69731117 CTGTGTTAGGTGAAATAAGCTGG - Intronic
1010875556 6:81100902-81100924 CTCTGCAAGATGAAATAAAAGGG - Intergenic
1013481352 6:110555528-110555550 ATGTGCAAGTTCATAAAAGAAGG - Intergenic
1014235037 6:118944370-118944392 CTGTGAAAGTAGTACTAAGAGGG + Intergenic
1015968879 6:138723420-138723442 CTGAGGAAGTTGAAAGTAGATGG - Intergenic
1017450716 6:154552139-154552161 TTGTGCAAAATGAAAGAAGAGGG - Intergenic
1019068103 6:169319569-169319591 CTGTGCAGCCTGAAATAAAAGGG - Intergenic
1019847488 7:3520808-3520830 CTGTGCAAGGTCTAATAAAAAGG - Intronic
1024412380 7:49060086-49060108 CTCTCCAAGATAAAATAAGAAGG - Intergenic
1025640867 7:63367426-63367448 TTGAGGATGTTGAAATAAGAAGG + Intergenic
1027847185 7:83395586-83395608 CTATGAAAGCTGAAACAAGAAGG - Intronic
1027876807 7:83781133-83781155 TTTTGCAAGCTGAAATAAAAGGG - Intergenic
1027914040 7:84291600-84291622 CTTTGCAACTTGAAAGAACATGG - Intronic
1028108021 7:86903391-86903413 CTGTGCAAGTTAAATTAAAAAGG - Intronic
1031419176 7:121529180-121529202 TTGTGCAACATGGAATAAGAGGG - Intergenic
1031432096 7:121684357-121684379 TGGTGCAAGTGGGAATAAGAAGG - Intergenic
1031621946 7:123945014-123945036 CTGTGTAAGTCATAATAAGAAGG - Intronic
1032941824 7:136802193-136802215 TTGTGCAAGTTGGAATAAGGCGG - Intergenic
1033011422 7:137626542-137626564 CTGTTCAATATGAAATAAGATGG + Intronic
1033358224 7:140618342-140618364 ATTTGAAAGTTGAAATAAGTTGG - Intronic
1033650973 7:143343390-143343412 ATGTGAAAGCTGAAACAAGAAGG + Intronic
1034106250 7:148493092-148493114 CTGTGCGAGCTTAAACAAGAAGG + Intergenic
1036205022 8:6799212-6799234 CTGAGTAGGTTGAAATGAGAAGG - Intergenic
1036438519 8:8758750-8758772 CTGTGAAAGTGGAAATGAGATGG - Intergenic
1037792466 8:21957829-21957851 GTGTGAAAGCTGAAACAAGAAGG - Intronic
1041864188 8:62550272-62550294 CTGTCCTAGTTCAAAGAAGATGG - Intronic
1044022063 8:87117075-87117097 ATGTTCAAGTAGATATAAGATGG - Intronic
1044413271 8:91908804-91908826 CTGTAGCAGTGGAAATAAGAGGG - Intergenic
1044964491 8:97562050-97562072 CTTTGCAAGTGGTCATAAGATGG + Intergenic
1045157978 8:99500846-99500868 CTGTTCAACTTTAAATAAAAGGG + Intronic
1045454242 8:102360239-102360261 CAATGCAATTTGAAATAACAGGG - Intronic
1047663883 8:127068305-127068327 CTATGTACATTGAAATAAGATGG - Intergenic
1048083126 8:131150076-131150098 ATGGGCAAGTTGAAATAACCTGG + Intergenic
1048341625 8:133544240-133544262 CAGTGCAAGTGGGAATAACAAGG - Intronic
1048675703 8:136776930-136776952 CTATGCAAGCTGAAATATGGAGG - Intergenic
1049130973 8:140840482-140840504 ATGTGTAAGTTGGAAGAAGATGG + Intronic
1052072854 9:24104608-24104630 CTGTAAAAGCTGAAATATGATGG - Intergenic
1054766028 9:69043182-69043204 CTATGACAGCTGAAATAAGAAGG - Intronic
1056390798 9:86139749-86139771 GTGTGAGAGTTGAAATAAGAGGG + Intergenic
1058211324 9:102173675-102173697 CTTTGCGAGTTGAGAGAAGAAGG - Intergenic
1058252688 9:102719997-102720019 CTGAACAAAGTGAAATAAGAAGG - Intergenic
1058477996 9:105360281-105360303 CTTTGCAATTTTATATAAGATGG - Intronic
1060378801 9:123144561-123144583 AATTGCAAGTTAAAATAAGAAGG + Intronic
1062052878 9:134456544-134456566 CTTTGCAAAGTGAAATCAGATGG - Intergenic
1185910170 X:3973669-3973691 CTATACAAGTTGAAATTATAAGG - Intergenic
1188538625 X:31224792-31224814 CTGTGCAAAGTGCAATAAAAAGG + Intronic
1190575855 X:51837220-51837242 CTGGGCAAGATGGAATAACAGGG - Intronic
1194279941 X:91938244-91938266 CTGTCCAAGATGGAATAAGAGGG + Intronic
1195897568 X:109762630-109762652 CTGTGAAATTTTAAATAAGTGGG - Intergenic
1196242380 X:113357488-113357510 ATGTGCAAGATGAATTAAAATGG + Intergenic
1199405142 X:147448756-147448778 ATGCACAAGCTGAAATAAGAAGG - Intergenic
1200597419 Y:5161745-5161767 CTGTCCAAGATGGAATAAGAGGG + Intronic
1201323738 Y:12731703-12731725 GCGTGCAAGTTGAAATACAAGGG - Intronic
1201347154 Y:12997783-12997805 CTGTGTAAGTTGAAATTATTTGG + Intergenic
1201904048 Y:19071767-19071789 CTGTGTAAGTGGAAAAAAAAGGG + Intergenic