ID: 1126838181

View in Genome Browser
Species Human (GRCh38)
Location 15:52688901-52688923
Sequence CTATTTTTACAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 459}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126838178_1126838181 3 Left 1126838178 15:52688875-52688897 CCAAAAGAGAAGGAATAACTTTG 0: 1
1: 0
2: 2
3: 31
4: 388
Right 1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG 0: 1
1: 0
2: 3
3: 44
4: 459
1126838177_1126838181 4 Left 1126838177 15:52688874-52688896 CCCAAAAGAGAAGGAATAACTTT 0: 1
1: 0
2: 3
3: 62
4: 562
Right 1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG 0: 1
1: 0
2: 3
3: 44
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126838181 Original CRISPR CTATTTTTACAGATGGAGGA AGG Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
901254902 1:7815108-7815130 GTATTTTTAGAGATGAAGTATGG - Intronic
902398426 1:16144695-16144717 CTCATTTTACAGATGGGGGTGGG + Intronic
903975564 1:27147634-27147656 GTTTTTTTAGAGATGGGGGATGG - Intronic
904511220 1:31009837-31009859 CTATATTTACATATGGAGGCTGG - Intronic
904594975 1:31638256-31638278 CCCATTTTACAGATGGGGGAGGG + Intronic
904716011 1:32468109-32468131 TTATTTTTTGAGATGGGGGATGG - Intronic
904800703 1:33091249-33091271 CTATTTTTTGAGATGGAGTCTGG + Intronic
905737965 1:40343767-40343789 CTAACTTTGAAGATGGAGGAAGG - Intergenic
907380038 1:54079565-54079587 CAAGTTTTGAAGATGGAGGAAGG - Intronic
907880347 1:58544363-58544385 CTATTTTTGCAAATTGGGGAGGG - Intronic
907920268 1:58905022-58905044 TTAATTTTACAGGGGGAGGAGGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909979570 1:82082611-82082633 CTAGTTTTGAAGATGGAGGAAGG - Intergenic
910047572 1:82936388-82936410 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
910550744 1:88471352-88471374 CCCATTTTAAAGATGGAGGAAGG - Intergenic
910594791 1:88968723-88968745 CTTCTTTTACATATGTAGGAGGG + Exonic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911225963 1:95305879-95305901 CTATTTTTCTAGATTGAGCAAGG + Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
912015760 1:105033500-105033522 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
912203649 1:107486225-107486247 CTATTCAGACAGATGTAGGAGGG - Intergenic
915400246 1:155616735-155616757 CTAGATTTAGAGATGGGGGAAGG + Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916856051 1:168751268-168751290 CTATGTTTACTGAATGAGGAGGG - Intergenic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
918036085 1:180873254-180873276 CTATTTTTACATGGGGAAGACGG - Intronic
918327327 1:183422377-183422399 AAATTTTTACACATGGTGGAAGG - Intergenic
918399228 1:184146967-184146989 CTAGCTTTGCTGATGGAGGAAGG - Intergenic
919323738 1:196079276-196079298 CCATTTCTTCAGATGGAGTATGG + Intergenic
922570619 1:226632782-226632804 CTTCTTTCACAGATGGAGTAAGG + Exonic
923055424 1:230423146-230423168 CTGTTTTTACAGTTGCAGCAAGG + Intronic
923299332 1:232627180-232627202 TTATTTTTTGAGATTGAGGAAGG - Intergenic
923678444 1:236100140-236100162 GGATTGTTGCAGATGGAGGAGGG - Intergenic
923907558 1:238402267-238402289 ATATTTTTACAAATGAAGAAAGG + Intergenic
924032671 1:239902311-239902333 CTAGTTTTATAGATGAAGAAAGG + Intronic
924039708 1:239972392-239972414 AGATGTTTATAGATGGAGGAAGG + Intergenic
924233835 1:241984240-241984262 GTATTTTTAGAGATGGGGGCTGG - Intergenic
1064416311 10:15153250-15153272 ATTTTTTTAGAGATGGCGGAGGG - Intronic
1064727555 10:18296928-18296950 CTCATTTTACAGATGAATGACGG - Intronic
1064834198 10:19507005-19507027 CTATTATGACAGATGGTGAAGGG + Intronic
1066076662 10:31885391-31885413 CTATTCTGACTGATGGAGGGAGG - Intronic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1066702102 10:38141243-38141265 CAATTTTAACATATAGAGGATGG + Intergenic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069516256 10:69079832-69079854 CTATTTTTTTGGATGGAGGGTGG + Intergenic
1072169594 10:92846976-92846998 CTAGCTTTGAAGATGGAGGAAGG + Intronic
1074681071 10:115908407-115908429 CTAGTTTTGAAGATGCAGGAAGG - Intronic
1075112522 10:119598613-119598635 CTTTTCTTGAAGATGGAGGATGG - Intergenic
1075512073 10:123080716-123080738 ATATTTTTTCTTATGGAGGAAGG - Intergenic
1075669984 10:124257671-124257693 CTACTTTTCCAGCAGGAGGAGGG + Intergenic
1075874361 10:125794207-125794229 CCAGTTTTAAAGATGGAGCACGG - Intronic
1078334750 11:10454790-10454812 CTATTCTGCCAGAAGGAGGAGGG - Intronic
1078870419 11:15339094-15339116 CTATTCTAACAAATGGAGCATGG - Intergenic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079687507 11:23378474-23378496 CCAATTTTTCACATGGAGGATGG + Intergenic
1079986575 11:27206449-27206471 CTAATTTTGATGATGGAGGAAGG + Intergenic
1080233604 11:30045034-30045056 CCATCTTTACAGATGGACGGAGG + Intergenic
1080606074 11:33865986-33866008 GGAATTTTACAGATGGAAGAAGG - Intronic
1081492836 11:43580801-43580823 CTTTTTTTTCAGAAGGGGGAGGG - Intronic
1081604338 11:44518010-44518032 CTATTTTTACACTTGGAAAATGG - Intergenic
1082569636 11:54722350-54722372 CTAGTTTTGAAGATGGAAGAGGG + Intergenic
1082641071 11:55662373-55662395 TTACTTTCACACATGGAGGATGG + Intergenic
1082766789 11:57175172-57175194 CTAGCTTTGGAGATGGAGGAAGG - Intergenic
1083020343 11:59500407-59500429 CTATTTTTTCATCTGTAGGATGG - Intergenic
1083667372 11:64283235-64283257 CTATTTTTAGAGATGGGGTCTGG + Intronic
1085417177 11:76327015-76327037 AAATTTTTTGAGATGGAGGATGG - Intergenic
1085679304 11:78556604-78556626 CTAGTTTTATAGATGGAAAAAGG - Intronic
1086439744 11:86816192-86816214 CTAATTGAAGAGATGGAGGAAGG - Intronic
1088019139 11:105098105-105098127 CTATGTATACATATGGAAGAAGG + Intronic
1088474095 11:110217249-110217271 CTGTTTTTACAGGTCGGGGATGG + Intronic
1088501552 11:110488363-110488385 CTATTTTTACACATGAAAGAAGG + Intergenic
1088631667 11:111779515-111779537 ATATTTTTACATATAGAGGCGGG + Intergenic
1090429937 11:126637182-126637204 CTATTTTTGGAGGTGGAGAATGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090945059 11:131422101-131422123 CTACTTTGCCTGATGGAGGAAGG + Intronic
1091424790 12:378077-378099 CTACTGTTAAAGATGGAGAATGG - Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092642730 12:10534433-10534455 CTATTCTGAAAGATAGAGGAGGG + Intergenic
1092671980 12:10873587-10873609 CTAGCTTTAAAGATGGAAGAGGG - Intronic
1092812797 12:12287379-12287401 ATATTGTTAAAGAGGGAGGAAGG - Intergenic
1093783614 12:23166822-23166844 CTATTTAGAAAGATTGAGGAAGG + Intergenic
1093991909 12:25598955-25598977 CTATTCTGAAAAATGGAGGAGGG + Intronic
1095359021 12:41313252-41313274 CTTTTGTAACAGATGAAGGATGG - Intronic
1096031659 12:48421532-48421554 TTTTTTTTTTAGATGGAGGATGG + Intergenic
1096033615 12:48443688-48443710 CTATGTTTACAAATGCACGAGGG - Intergenic
1096159569 12:49366007-49366029 ATATTTTTTGAGATGGAGGGTGG + Intergenic
1097933347 12:65215308-65215330 CTATATTTACAGAAGAAGGAGGG + Intronic
1098335032 12:69395183-69395205 TTATTTTCACAGAAGGAAGAAGG + Intergenic
1098380958 12:69869114-69869136 CCATTTTTATAGTTGGAGGATGG + Intronic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099293454 12:80801384-80801406 CTCGTTTTGAAGATGGAGGAAGG + Intronic
1099417422 12:82408675-82408697 CTATTTTGATAGATGGAATATGG + Intronic
1099487794 12:83249610-83249632 CTATTCTGACATCTGGAGGATGG - Intergenic
1099811424 12:87587322-87587344 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1101664303 12:106796369-106796391 TTCTTTTTAGAGATGGAGGGGGG - Intronic
1105386033 13:19930394-19930416 TTATTTTTTGAGATGGAGGATGG - Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1108386259 13:49901956-49901978 GTATTTTTTCACAGGGAGGAGGG - Intergenic
1108438082 13:50420975-50420997 CTATTTTTAAAAAGTGAGGATGG + Intronic
1109019258 13:57064526-57064548 CTAGGCTTCCAGATGGAGGAGGG - Intergenic
1109126167 13:58520270-58520292 TTCTTTTTAGAGATGGGGGAGGG + Intergenic
1109220488 13:59636448-59636470 CTACTTCAACAGATGGAGGTTGG + Intergenic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1110571017 13:77003644-77003666 CTATTGTTATAGATGTAGGCTGG + Intronic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111617340 13:90676964-90676986 CTATTTTGAGAGATGGAAAATGG + Intergenic
1112517341 13:100065940-100065962 CTTTTTTTTGAGATGGAGGCTGG + Intergenic
1113426923 13:110215890-110215912 CCATTTTTACAAACGCAGGAAGG + Intronic
1113766518 13:112884293-112884315 CTATTTTTAAGGCTGAAGGATGG - Exonic
1113859054 13:113469215-113469237 CTAGTCTTTCAGAAGGAGGATGG - Intronic
1113944972 13:114038946-114038968 TTATTTTTACACCTGGAGGCTGG - Intronic
1114197212 14:20489413-20489435 CTAGTTCTACAGAAGGAGGGTGG + Intergenic
1114389072 14:22286407-22286429 CTAGTTTTGAAGATGGAAGAGGG - Intergenic
1115749818 14:36477868-36477890 TTTATTTTATAGATGGAGGAGGG - Intronic
1115814501 14:37148489-37148511 CTTATTTTACTGATGGTGGAGGG - Intronic
1116187944 14:41623005-41623027 CTATGCTTACAGTTAGAGGAAGG + Intronic
1117814205 14:59580491-59580513 CTAGTTTTGAAGATGGAGGAAGG + Intergenic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118270933 14:64341439-64341461 CTAGTTTTAAAGATGGAGGAAGG + Intergenic
1118790533 14:69087762-69087784 TTATTTTAAAAGATGGAGGAAGG + Intronic
1119018648 14:71085882-71085904 CTATTTTTAATAATGGTGGAAGG - Intronic
1119067092 14:71539826-71539848 CTATTTTGGGAGATCGAGGAAGG - Intronic
1119302021 14:73579069-73579091 CTTTTTTTTGAGATGGAGGCTGG - Intergenic
1119479872 14:74952455-74952477 CCATTTTTACAGATGCAGGCAGG - Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119654943 14:76410553-76410575 CCCATTTTACAGATGGAGAATGG + Intronic
1120793129 14:88603853-88603875 CTATTTTTAATGATCGAGAAAGG - Intronic
1120817688 14:88880772-88880794 CTATTTTTAAAAAGGGAGGCAGG - Intronic
1120992767 14:90392748-90392770 CTATTTTTACATAAGGAATATGG - Intergenic
1121203175 14:92138109-92138131 CTACTTTTATAGTTAGAGGAGGG + Intronic
1122454521 14:101839654-101839676 TTATGATTACAGATGGAGGATGG - Intronic
1122497621 14:102170470-102170492 CTAATTTGACAGATGAAAGATGG + Intronic
1126484406 15:49164077-49164099 CTATTTATAGAGATGGAGGCAGG + Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127342335 15:58060616-58060638 CTCTTTTTCCAAATGAAGGAAGG + Intronic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1128411811 15:67406782-67406804 CTCTCTTTACAGATAGAGAAAGG - Intronic
1130735716 15:86546492-86546514 CTCATTTTACAGATGGCAGAAGG - Intronic
1131621096 15:94068904-94068926 CTAATTTTGAGGATGGAGGAAGG + Intergenic
1131940387 15:97558417-97558439 CTAGATTTGAAGATGGAGGAAGG - Intergenic
1132354413 15:101160502-101160524 CTATTGCTGGAGATGGAGGAGGG + Intergenic
1134165756 16:11927991-11928013 CTATTTTGAAACCTGGAGGATGG - Intronic
1134276952 16:12785259-12785281 TTATTTTTACAGATGGGGTCTGG + Intronic
1134500351 16:14764869-14764891 CTATTTTGAAACCTGGAGGATGG + Intronic
1134526892 16:14951481-14951503 CTATTTTGAAACCTGGAGGATGG + Intronic
1134545512 16:15104870-15104892 CTATTTTGAAACCTGGAGGATGG - Intronic
1134580228 16:15364181-15364203 CTATTTTGAAACCTGGAGGATGG - Intronic
1134714469 16:16349958-16349980 CTATTTTGAAACCTGGAGGATGG + Intergenic
1134722344 16:16393322-16393344 CTATTTTGAAACCTGGAGGATGG + Intronic
1134787138 16:16954857-16954879 TTAATATTACAAATGGAGGAAGG + Intergenic
1134945083 16:18318547-18318569 CTATTTTGAAACCTGGAGGATGG - Intronic
1134952347 16:18358700-18358722 CTATTTTGAAACCTGGAGGATGG - Intergenic
1135311148 16:21405405-21405427 CTATTTTGAAACCTGGAGGATGG - Intronic
1135353105 16:21746580-21746602 CTGATTTTGGAGATGGAGGATGG + Intronic
1135364100 16:21837856-21837878 CTATTTTGAAACCTGGAGGATGG - Intronic
1135447742 16:22533492-22533514 CTATTTTGAAACCTGGAGGATGG + Intronic
1135451592 16:22562703-22562725 CTGATTTTGGAGATGGAGGATGG + Intergenic
1135592519 16:23714479-23714501 TTATTTTTACACAAGGATGAAGG - Intergenic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1136150301 16:28343300-28343322 CTATTTTGAAACCTGGAGGATGG - Intronic
1136166538 16:28457138-28457160 CTATTTTGAAACCTGGAGGATGG - Intronic
1136196436 16:28657894-28657916 CTATTTTGAAACCTGGAGGATGG + Intronic
1136212776 16:28772019-28772041 CTATTTTGAAACCTGGAGGATGG + Intronic
1136257499 16:29051938-29051960 CTATTTTGAAACCTGGAGGATGG + Intronic
1136307852 16:29384401-29384423 CTATTTTGAAACCTGGAGGATGG - Intronic
1136321268 16:29485945-29485967 CTATTTTGAAACCTGGAGGATGG - Intronic
1136435948 16:30225915-30225937 CTATTTTGAAACCTGGAGGATGG - Intronic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1139164061 16:64545463-64545485 GTATTTTTAGAGTTGGAGGCAGG + Intergenic
1139855542 16:69976844-69976866 CTATTTTGAAACCTGGAGGATGG - Intergenic
1140346890 16:74221886-74221908 CTATTCTGGCAGATGGAGGCTGG + Intergenic
1140348000 16:74233675-74233697 TTATTTTTTCAGATGGAGTCTGG - Intergenic
1140367191 16:74391257-74391279 CTATTTTGAAACCTGGAGGATGG + Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140578751 16:76203445-76203467 CTAATTTTGAAGGTGGAGGAAGG - Intergenic
1140700510 16:77577171-77577193 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1140937879 16:79691563-79691585 CTAGTTTTCAAGATGGAGAAAGG + Intergenic
1141913045 16:87073303-87073325 CATTATTTACAGATGAAGGACGG - Intergenic
1142686772 17:1581645-1581667 CTAAATTTACAAATGGTGGAGGG - Intronic
1144210839 17:13013971-13013993 CTATTTTTACAGCATGAGGTGGG + Intronic
1144311652 17:14019414-14019436 AGAGTTTTACAGATGGAGGGTGG + Intergenic
1144342806 17:14324155-14324177 CTGTTTTTACACATGGAGACAGG + Intronic
1144917121 17:18733382-18733404 CTATTATTACAAATGGAGAGGGG + Intronic
1145082466 17:19906286-19906308 CTATTATTACAAATTAAGGATGG + Intronic
1145201380 17:20948302-20948324 TTATTTTTAGAGATGGGGGGGGG + Intergenic
1145902576 17:28498120-28498142 CGGTTTTTCCAGCTGGAGGAAGG - Intronic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1146834772 17:36101854-36101876 TGATTTTTACAGATGGTGTAAGG + Intergenic
1146849379 17:36209036-36209058 TGATTTTTACAGATGGTGTAAGG + Intronic
1148835797 17:50465165-50465187 CCATTTTTACAGAGAGAGGAGGG - Intronic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1151486467 17:74404149-74404171 CTATTTTCTCAGATGTGGGAGGG - Intergenic
1152601930 17:81267406-81267428 CTATTTTAAAAGAAGAAGGAGGG - Intronic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153552883 18:6280818-6280840 CTAGTTTTGAAGATGGAGGAAGG + Intronic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1154117013 18:11620032-11620054 CTATTTTGAAACCTGGAGGATGG - Intergenic
1154130466 18:11732708-11732730 CAACATTTACAAATGGAGGAGGG + Intronic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1155843398 18:30674789-30674811 CAAATTTTGAAGATGGAGGAAGG - Intergenic
1156094105 18:33509306-33509328 CTATTGTTACTCTTGGAGGAGGG - Intergenic
1157056548 18:44235656-44235678 CTAGCTTTGCAGATAGAGGAAGG - Intergenic
1158377670 18:56889255-56889277 CTATTTTAACAAATGGAGAGAGG + Intronic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1159840668 18:73394949-73394971 CTGGCTTTACAGATGGATGAAGG - Intergenic
1161338334 19:3726680-3726702 CTATTTTTATAGAGACAGGAGGG - Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1163562560 19:18028836-18028858 CTTTTTGTAAGGATGGAGGAGGG - Intergenic
1163782273 19:19256818-19256840 CCATGGTTACAGCTGGAGGAGGG + Exonic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1168441554 19:56372017-56372039 CTGTTGTTACAGATGGTGCAAGG + Intergenic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
925467950 2:4126786-4126808 TTATTTTTAAAGATGAAGAAAGG + Intergenic
925568040 2:5277863-5277885 GAATTTGTCCAGATGGAGGAAGG - Intergenic
926047910 2:9723655-9723677 CTATTTTTTCAGATAGAAGTGGG - Intergenic
926381500 2:12295078-12295100 CACTTTTTACAGATGTAGGGAGG + Intergenic
926412219 2:12616284-12616306 CAATTTTGGCAGCTGGAGGAAGG + Intergenic
928530765 2:32188662-32188684 TTATTTTTTGAGACGGAGGATGG - Intronic
929018279 2:37524193-37524215 CTCATTTTTCAAATGGAGGAGGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
931265591 2:60657260-60657282 CCATTTTTACAGTGAGAGGAAGG - Intergenic
931895962 2:66729927-66729949 TTTTCTTTATAGATGGAGGAGGG + Intergenic
932325826 2:70860983-70861005 CTACTTTTCCCCATGGAGGAAGG - Intergenic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
933313079 2:80684720-80684742 CTAGTTTTGAAAATGGAGGAAGG - Intergenic
934090912 2:88549829-88549851 CTCTTGTGACAGATGCAGGAGGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936711002 2:115131175-115131197 CTATTTTCATAGATGTTGGAAGG - Intronic
936733303 2:115409016-115409038 CCATTTTTAAAGATAAAGGAAGG + Intronic
937659586 2:124415175-124415197 CTCTTTATCCAGATGGAGAATGG - Intronic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938324454 2:130389061-130389083 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
938795392 2:134714729-134714751 AGATTTTTACAGAGAGAGGATGG - Intronic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939008967 2:136822534-136822556 CCCATTTTACAGATGAAGGAAGG + Intronic
940569960 2:155418306-155418328 CTATTTTTACTGAGGGAGGAGGG - Intergenic
940986322 2:160055706-160055728 CTTCTTTTACAGATGAAGAAGGG - Intronic
941764236 2:169278950-169278972 AGATTTTTAAAGATGGAGGTTGG - Intronic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943416208 2:187608918-187608940 CTATTTTTAAAAATGAAAGAAGG + Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943659302 2:190540766-190540788 CTCTTTTTAAAAATTGAGGAGGG - Intergenic
943727891 2:191270594-191270616 CTATTTTAAAAGATCTAGGAAGG + Intronic
944400778 2:199323730-199323752 GTATTTTTATTGGTGGAGGAAGG + Intronic
945635739 2:212347976-212347998 CTATTTTTATATATGTTGGATGG + Intronic
946227839 2:218273858-218273880 ACAGTTTTGCAGATGGAGGAGGG - Intronic
1169163699 20:3405252-3405274 TCATTTTCACAGATGGAGAATGG - Intronic
1171234193 20:23510933-23510955 CTAATCCTACAGATGGAGAAGGG + Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173675074 20:44826632-44826654 CTAGTTTTAGAGAATGAGGATGG - Intergenic
1173683198 20:44902090-44902112 CAATTTTAAAAGATGGAGGGAGG - Intronic
1174465674 20:50715369-50715391 CTGATTTTAAAGATGGAGGTGGG + Intergenic
1174919328 20:54684959-54684981 GTATTTTTATAGATGCAGGGAGG + Intergenic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1178674474 21:34619214-34619236 TTTTTTTTTCAAATGGAGGAAGG + Intergenic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1181837382 22:25622051-25622073 CTATTTTGACAAAGAGAGGAGGG - Intronic
1182375394 22:29843563-29843585 CTATTTTTAAAAATTGAGGTGGG - Intergenic
1183586705 22:38756910-38756932 CTATCTGTACAGTTGGCGGATGG - Intronic
949429299 3:3956896-3956918 CTAAGATTACAGTTGGAGGAAGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
952065700 3:29567346-29567368 CAATTTTTACATATGGAGACAGG - Intronic
953617462 3:44504108-44504130 TTATTTTTATAGATGGAGTGAGG - Intronic
954611473 3:51946737-51946759 TTATTTTTTCAGATGGAGTCTGG - Intronic
955375698 3:58394802-58394824 CTCCTTCTTCAGATGGAGGAAGG - Intronic
955460447 3:59176711-59176733 CTATTCTGAAAAATGGAGGAGGG - Intergenic
955600638 3:60641841-60641863 CTATTTTCAGAGGTGGAGGTTGG + Intronic
956004260 3:64762066-64762088 ATATTTTGAGAGGTGGAGGAGGG - Intergenic
956263673 3:67373826-67373848 CCATTTTTACAGGTGGATAATGG - Intronic
956498352 3:69853538-69853560 CTATTTTTTAAGATGGATGGTGG - Intronic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957297503 3:78352016-78352038 CTCTTTTTACAGTTGGGGGTGGG - Intergenic
957651894 3:83018184-83018206 CTATTTTTTTGGATGGAAGAGGG - Intergenic
958596455 3:96231617-96231639 CTAGATTTAAAGATGGAGAATGG - Intergenic
958642117 3:96817399-96817421 CTATTTTTAAACATGGAAAATGG + Intronic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
959309685 3:104717921-104717943 TTATTTTTACAGAAAGAGGAAGG - Intergenic
959451180 3:106503330-106503352 TTATTTTTATTGATTGAGGATGG + Intergenic
959611922 3:108304847-108304869 CTATTTATACAGCTGCAGGCAGG - Intronic
961804023 3:129475969-129475991 CTATATTTGCAGAGGGAGGGGGG + Intronic
961926682 3:130488805-130488827 CTATTTTTATTCATAGAGGAAGG + Intergenic
961990172 3:131181269-131181291 CTAGCTTTGAAGATGGAGGAAGG + Intronic
962274901 3:134004712-134004734 CTAGTTTTGAGGATGGAGGAAGG + Intronic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
964028121 3:152102980-152103002 CAATTCTGACAGTTGGAGGAAGG - Intergenic
964939784 3:162143802-162143824 CTTTATTTAAAGAGGGAGGAAGG - Intergenic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
966721965 3:183072382-183072404 CTCTAATTGCAGATGGAGGAGGG + Exonic
966723935 3:183091664-183091686 ATAATTTTACAGATGAAGCAAGG + Intronic
967056129 3:185829942-185829964 GAATTTTTAAACATGGAGGATGG + Intergenic
967779473 3:193419712-193419734 CTATTTTTCCTGTTGGGGGAAGG - Intronic
970482861 4:16495422-16495444 CAATTTTTTCTTATGGAGGATGG + Intergenic
970743224 4:19263007-19263029 CTACTTTTAAAAATGGAGAAAGG - Intergenic
971385511 4:26137777-26137799 GTATTTTGACAGATGGAGGGAGG - Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
972618258 4:40721362-40721384 CTATTGTAACAGATGTGGGAAGG - Intergenic
972646865 4:40976746-40976768 CTATTTATTCAGATGGGGCAAGG + Intronic
972739071 4:41873829-41873851 CTATTATTACTAATGGGGGAGGG - Intergenic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
972777155 4:42252006-42252028 CTTATTATACAGATGCAGGACGG + Intergenic
972867279 4:43248694-43248716 CTATTTTGAAAAATAGAGGAGGG - Intergenic
973164082 4:47055047-47055069 TTATTCTTACAGTTGGAGGTAGG + Intronic
974382598 4:61160635-61160657 CTATTTCCATTGATGGAGGAGGG + Intergenic
974587129 4:63894065-63894087 CTATTTTCACAAGTGGAAGAAGG + Intergenic
974776214 4:66485430-66485452 ATATTTTTACAGATAGAAGAAGG - Intergenic
975172575 4:71249354-71249376 CTATTTTTATATATGGATAAGGG - Intronic
975663991 4:76715925-76715947 GCATTTTTGCATATGGAGGAGGG + Intronic
975712676 4:77176159-77176181 TTATTTTTAAAGATTGAAGAGGG + Intronic
976083266 4:81380000-81380022 CTATTTTAACAAATGGAGGTGGG + Intergenic
976652889 4:87454974-87454996 CTGTTATTACAGAAGGAGAAAGG + Intronic
977382241 4:96290543-96290565 CTATTTTTCAAGTTGGATGATGG - Intergenic
977764110 4:100777134-100777156 CTATCTCTACAGAGGGAGGGTGG + Intronic
978692158 4:111526715-111526737 CTATTTTTAAAAATAGAGAAGGG - Intergenic
979202425 4:117994222-117994244 CTAGTTTTGAAGATGGAAGAGGG - Intergenic
979350608 4:119640530-119640552 GTATTTGAACAGATGGAGAAAGG - Intergenic
980370253 4:131860574-131860596 CTCATTTTAGAAATGGAGGAAGG - Intergenic
981091742 4:140739365-140739387 TTATTTTTACAAAAGGAGGGAGG - Intronic
981400162 4:144304315-144304337 TTATTTTTGCAGGTGGAGGGAGG - Intergenic
981945204 4:150334612-150334634 CTATTTTCTCTGATGGAGGAAGG + Intronic
982810337 4:159817910-159817932 CTATTCTTACAGATGTGAGATGG - Intergenic
982846027 4:160253386-160253408 CTAATTTTAAAGATGAGGGAGGG - Intergenic
983884805 4:172968505-172968527 CTTTTTTTGTAGAGGGAGGAGGG - Intronic
984041153 4:174735570-174735592 TTATTTTTTGAGATGGAGCATGG + Intronic
984716213 4:182927860-182927882 CTATGTCTAGAAATGGAGGATGG - Intergenic
986611448 5:9571989-9572011 CCATTTGTACAGATGAAGAATGG - Intergenic
986744084 5:10729299-10729321 CTATTTTCAAAGATGGTGGTGGG - Intronic
989437460 5:41431827-41431849 TTATTTTTAGAAATGTAGGAGGG + Intronic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
991307918 5:65200739-65200761 CTTTTTTTAAGCATGGAGGAAGG - Intronic
991545087 5:67772749-67772771 TTATTTTTAAAGATAGTGGAAGG - Intergenic
992204581 5:74418818-74418840 GTATTTTTACAGGTGGAGGTGGG - Intergenic
992755477 5:79901659-79901681 CTATTTTCATTGATGGAGTAAGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
993776395 5:92003499-92003521 CTATTTGTAGAGAGGAAGGAAGG + Intergenic
994896224 5:105706912-105706934 TTTTTTTTTAAGATGGAGGAAGG + Intergenic
995936244 5:117519072-117519094 CTAGCTTTAAAGATGGAGGAAGG - Intergenic
996022572 5:118607729-118607751 CTAGTTGTACAGAAGAAGGAAGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
997802744 5:136882882-136882904 CCATTTTCACAGAAGGTGGATGG + Intergenic
998692238 5:144599411-144599433 TTTTTTTTACAGATGGAGTCTGG + Intergenic
998765974 5:145487716-145487738 CATTTTTTAGAGATGGAGGAAGG + Intronic
999531751 5:152470671-152470693 CTTTGGTTAAAGATGGAGGAAGG + Intergenic
1000355474 5:160390237-160390259 CTATTTTTAAAAATTGAGGCTGG + Intergenic
1000895266 5:166847596-166847618 CTATTTTTGAAGATAGAGGAGGG + Intergenic
1001438412 5:171719113-171719135 CTTTTTTTTGAGATGGAGGCTGG + Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1002684800 5:181001487-181001509 ATATTTTTATAGATGGGGGGGGG + Intronic
1003589453 6:7424951-7424973 CTATTTTTTGAGATGGAGTCTGG - Intergenic
1003597604 6:7488084-7488106 CAATTTTTAAAAATTGAGGATGG + Intergenic
1004285852 6:14320024-14320046 ATCTTTTTACAAATGGAGCAAGG - Intergenic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1005055728 6:21727185-21727207 CTATATTTGCTGATGGAGGAGGG - Intergenic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006541325 6:34742550-34742572 CTATTTTTTCAGATGTATAAAGG + Intergenic
1006725871 6:36198323-36198345 CTCATTTTACTGATGGAGTATGG + Intronic
1006815909 6:36849707-36849729 ATATTTTTTCAGCTGGAGGGAGG + Intergenic
1006846914 6:37068792-37068814 CGATTTTTATAGAGGGAAGATGG - Intergenic
1007519911 6:42443984-42444006 CTCTTTTTACAGATGTAGAGAGG + Intronic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1009976704 6:70678761-70678783 CTAGTTTCAAAGATGGAGGAAGG - Intronic
1010025337 6:71209029-71209051 TTATTTTTAGAGATGGGTGAGGG - Intergenic
1012021348 6:93924918-93924940 ATAATTTTACAGGTAGAGGATGG - Intergenic
1012465640 6:99514279-99514301 GCATTTTCACTGATGGAGGAAGG - Intronic
1012586433 6:100928594-100928616 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1012734702 6:102924182-102924204 CAATTTTTACAGATTCAGAAAGG - Intergenic
1013204325 6:107933135-107933157 CCCTTTTTAAAGATGAAGGAAGG + Intronic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1013857224 6:114588336-114588358 CCATTTTTACACAGGGAGTAAGG - Intergenic
1013861439 6:114640435-114640457 GTAGTTTTGAAGATGGAGGAGGG + Intergenic
1014155327 6:118102984-118103006 CTAATTTTACAGATGGGTAAAGG - Intronic
1014311147 6:119803318-119803340 CTAATTTTAAAAAAGGAGGATGG - Intergenic
1014734716 6:125078877-125078899 CTATTTGTGGAGATGGGGGAGGG - Intronic
1014916969 6:127162442-127162464 CTGTTTTTACAAAGGAAGGAAGG - Intronic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016599057 6:145836105-145836127 CTTTTTTTTCAGAAGGAGGCAGG - Intergenic
1018006735 6:159629313-159629335 TTATTTTTTGAGATGGAGGTTGG - Intergenic
1018176141 6:161180986-161181008 CTATCTGTAAAGATGGAGGAGGG + Intronic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1019017600 6:168891131-168891153 CAAGTTTTACAGATGGTGGCAGG + Intergenic
1019131914 6:169883159-169883181 AAATCTTTGCAGATGGAGGAAGG + Intergenic
1019657035 7:2201372-2201394 CTACTTTTACAGGTAGAGCAGGG - Intronic
1020772556 7:12413392-12413414 CTGGTTTTAAAGATGAAGGAAGG - Intergenic
1022287553 7:28968662-28968684 CTAGTTTTGAAAATGGAGGAGGG + Intergenic
1023156123 7:37254166-37254188 CTATTTTCGGGGATGGAGGAAGG - Intronic
1023711158 7:42994368-42994390 CTATATTAAGAGATGGAGGGAGG - Intergenic
1024589628 7:50870161-50870183 CTAATTTTGCAGATGGGAGAAGG + Intergenic
1024714283 7:52057495-52057517 ATACTTTTGCAGATGGGGGAAGG - Intergenic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1027554271 7:79643625-79643647 CTATTTTTATATATGGTGAAAGG + Intergenic
1027776887 7:82476407-82476429 CTACTTTTACATATGAAGAAAGG + Intergenic
1028949412 7:96618064-96618086 CTATTTTTAAAAAATGAGGAGGG - Intronic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1030177567 7:106670737-106670759 CTAGCTTTCAAGATGGAGGAAGG - Intergenic
1030190143 7:106802355-106802377 CTATTACTACAGATTGAGAAGGG + Intergenic
1030190365 7:106804531-106804553 CTATTGTGACAGAGGGAGAAAGG + Intergenic
1030796994 7:113801278-113801300 ATATTTTTACAAAGGGATGATGG - Intergenic
1030935704 7:115583381-115583403 CTACTTTTAGAGATTAAGGATGG + Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031470304 7:122160484-122160506 CTTTTATTAAAGATGGTGGATGG - Intergenic
1031549256 7:123088223-123088245 TTATTATCACAGCTGGAGGAAGG - Intergenic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1033462232 7:141557368-141557390 ATATTTTAACAAATGGAGCATGG + Intronic
1034476109 7:151283277-151283299 CCATATTAACAGATGGAAGAAGG + Intergenic
1034762300 7:153684366-153684388 CTTATTTTACAGATGAAGGCAGG + Intergenic
1035691824 8:1564323-1564345 CCAGTTTCACAGATGGTGGATGG + Intronic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037586914 8:20283344-20283366 CTATGTCTTCAGATGGTGGAAGG - Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1039676923 8:39678376-39678398 GTAATTTCACATATGGAGGAGGG - Intronic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040950943 8:52939025-52939047 CTATTATTTCAGATGGAGTGAGG + Exonic
1041081707 8:54220853-54220875 CTTTATTTACAGATTGAGGTGGG + Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041365431 8:57098154-57098176 CTATTTTCACAGAAGGAGTTAGG + Intergenic
1042559311 8:70061080-70061102 CTGTTTTTATCAATGGAGGAGGG + Intronic
1042853786 8:73243532-73243554 CTTTTTTTTGAGATGGAGGATGG + Intronic
1043488529 8:80723568-80723590 GTATTTTTAAAAATGGATGATGG + Intronic
1043825164 8:84919050-84919072 CTCTTTTGACACATGCAGGATGG + Intronic
1044192691 8:89338123-89338145 CTATTTTGAAAAATAGAGGAGGG - Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044378771 8:91507010-91507032 CTCTTTTGAAAGATGGAGGAGGG - Intergenic
1044379232 8:91514321-91514343 TTATTCCTACAGATTGAGGAGGG - Intergenic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1045769643 8:105720902-105720924 CTACTTTTACAGATGCAGCAAGG - Intronic
1045870109 8:106916894-106916916 CTATTTTTAAGAATGGAAGAAGG - Intergenic
1046124298 8:109884885-109884907 CTGGTGTTAAAGATGGAGGAAGG - Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1047457137 8:125025329-125025351 TTATTTTTACAGTGGGTGGAGGG + Intronic
1048894143 8:138974168-138974190 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1048936874 8:139364771-139364793 TTATTCTTACAGTTGCAGGATGG - Intergenic
1050452061 9:5792384-5792406 CTAGTTTTAAAGATGGAAAAGGG + Intronic
1050784037 9:9376390-9376412 ATAATTTGACTGATGGAGGAAGG - Intronic
1051046941 9:12886962-12886984 CTGTTTTGACATATGGAGAAAGG - Intergenic
1053051460 9:34964377-34964399 TTATGTTTTCAGATGGAGGGTGG - Intronic
1053634831 9:39987063-39987085 CTCATTTTAAAAATGGAGGAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053771095 9:41477271-41477293 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054209056 9:62263634-62263656 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054315756 9:63584505-63584527 CTCATTTTAAAAATGGAGGAAGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054549829 9:66389076-66389098 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054783361 9:69186738-69186760 GTAGTGTTACAGCTGGAGGAAGG + Intronic
1056480213 9:86995774-86995796 TTATTTATACAGAGGGAGGAGGG - Intergenic
1057436176 9:95042668-95042690 CTAGCTTTAAAGATGGAGGAAGG - Intronic
1058587261 9:106522893-106522915 CTATTCTAAAAGATGGAGGAGGG + Intergenic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1059693409 9:116708079-116708101 CTATTTTAACTAACGGAGGAGGG - Intronic
1059949866 9:119451090-119451112 CTGGTTTTAAAGGTGGAGGAAGG - Intergenic
1059983813 9:119801949-119801971 TTATTTTTACAGATAGAGCAAGG + Intergenic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1060957194 9:127650612-127650634 CTGTTTTTAGAGCTTGAGGAGGG + Intronic
1061648267 9:132024315-132024337 CTCCTTTTACAGATGAAGAATGG + Intronic
1062292241 9:135801325-135801347 CTGGTTTTGCAGATGGAGGGAGG - Intergenic
1186426725 X:9468395-9468417 CTAATTTAACAGTTGCAGGAAGG - Intronic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186622880 X:11260113-11260135 CTAGCTTTACAGATGGAAAAAGG + Intronic
1188193708 X:27204206-27204228 ATATCATTACAGATGGAGTAGGG - Intergenic
1188508592 X:30909924-30909946 CTATTTTTAGAGATGAAACAAGG - Intronic
1188678549 X:32973398-32973420 CTACTTCAACAGATAGAGGATGG + Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189609780 X:42719966-42719988 ATATTTTGACAGAGAGAGGAGGG + Intergenic
1189620052 X:42826246-42826268 CTAGCTCTAAAGATGGAGGAAGG - Intergenic
1189722298 X:43932863-43932885 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1190323049 X:49189482-49189504 CTATTTTTTTGGTTGGAGGAAGG - Intronic
1190522616 X:51295670-51295692 CTTTTTTTTCAGAGGTAGGAAGG - Intergenic
1191901491 X:66045337-66045359 CTAACTTTGAAGATGGAGGAAGG + Intergenic
1192118729 X:68434859-68434881 CTAGCTTTAAAGACGGAGGAAGG - Intergenic
1193752842 X:85367739-85367761 ATATTTTTAAAGTTGGAGAATGG + Exonic
1194567941 X:95517026-95517048 CTTTGTTTCCAGATGGAGAAGGG + Intergenic
1195376752 X:104235073-104235095 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1196573833 X:117295475-117295497 GTATCTTTATAGATAGAGGAGGG - Intergenic
1196698086 X:118635286-118635308 CGATTTTTACAGTTAGAGGAGGG + Intronic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1197632878 X:128882316-128882338 CTACTCTGACAGATGTAGGAGGG - Intergenic
1197788273 X:130222836-130222858 GTATTTTTAGAGATGGGGCAGGG + Intronic
1199405054 X:147447251-147447273 CTATTGTGAAAAATGGAGGAGGG - Intergenic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1200058559 X:153473986-153474008 CTATCCTTGCAGATGGGGGAAGG + Intronic
1200503277 Y:3979362-3979384 CTATTCCAATAGATGGAGGAGGG - Intergenic
1201863058 Y:18620814-18620836 TCATTTTTACAGCTGGAGCAAGG + Intergenic
1201870265 Y:18699564-18699586 TCATTTTTACAGCTGGAGCAAGG - Intergenic
1201972587 Y:19813637-19813659 CTATTATTATAGATGGAGTCTGG - Intergenic
1202106260 Y:21370200-21370222 ATATTTTTAAAGATAGAGAAGGG + Intergenic