ID: 1126838945

View in Genome Browser
Species Human (GRCh38)
Location 15:52696880-52696902
Sequence ATTATATTCTGGGGGATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126838945 Original CRISPR ATTATATTCTGGGGGATTCA TGG Intronic
901265309 1:7905768-7905790 CTTATTTTCTGGTGGTTTCAAGG + Intergenic
901880195 1:12189200-12189222 ATTAGCTCCTGGGGGAGTCAGGG + Intronic
904338211 1:29811530-29811552 CTTATGTTCTGGAGGATTCTGGG - Intergenic
907308271 1:53525547-53525569 CTTATATTCTGGGTGAGCCATGG - Intronic
907896577 1:58698388-58698410 ATTATATTCTGGGCCAGGCATGG - Intronic
908041041 1:60113615-60113637 ATACTATTCTGGGGGTTTCCTGG - Intergenic
908428885 1:64036459-64036481 AGTATATTCTGGGAGACTCCTGG - Intronic
908504082 1:64777323-64777345 ATGATATTCTGGGGGGTTTTTGG - Intronic
908625707 1:66039009-66039031 ATCAAATTCTGTGGGATTCTGGG - Intronic
909372892 1:74906862-74906884 ATTATATGCTGTTGGCTTCAGGG - Intergenic
912140820 1:106724526-106724548 ATTCTATTGTATGGGATTCAAGG - Intergenic
917903229 1:179564484-179564506 ATGACAGTCTGGGGGAGTCAAGG + Intronic
918293483 1:183132607-183132629 ATTAAATGCTGGTGCATTCAGGG + Intronic
921637513 1:217513737-217513759 AATATATTCTGGTTGTTTCATGG + Intronic
924395502 1:243615543-243615565 ATTTTATTCAGGGGGATGAAAGG + Intronic
1062920348 10:1274313-1274335 ATCCGATTCTGGGTGATTCATGG + Intronic
1063679221 10:8171287-8171309 ATAATATTCTGGGTGCTTCTGGG - Intergenic
1065701683 10:28431820-28431842 ATTATATTTTGTTGGATTGAGGG + Intergenic
1067139821 10:43648080-43648102 ATCATATCCTGGGGGAGCCACGG - Intronic
1068305997 10:55209017-55209039 GTTATATTCTGGGGGACTGAAGG + Intronic
1069222420 10:65901377-65901399 ATCATCTTCTGAGGAATTCAGGG - Intergenic
1070020596 10:72581766-72581788 ACTATATTCTGGAAGATGCAGGG + Intronic
1071344122 10:84675138-84675160 TTTTTATTCTGTGGGTTTCAAGG - Intergenic
1075106038 10:119540689-119540711 ATTGTATCCTGGGAGATACATGG - Intronic
1076052276 10:127345410-127345432 ATTCTAATCTAGGCGATTCAGGG + Intronic
1079204001 11:18398116-18398138 ATTATATTGTGGATGATTTAGGG + Intronic
1080336140 11:31198501-31198523 ATTATTATTTGGGGAATTCATGG + Intronic
1089712884 11:120329292-120329314 ATTATATTCCAGGGGAGTTAAGG - Intronic
1093244430 12:16718878-16718900 ATTTTATTCTTTGGGTTTCATGG - Intergenic
1094028150 12:25980897-25980919 AACATATTTTGGGGGATTGAGGG + Intronic
1097501431 12:60409258-60409280 ATGAGATTTTGGAGGATTCAGGG - Intergenic
1099242567 12:80155393-80155415 GTTATATTCTAGGGGTTTTATGG + Intergenic
1107047344 13:36007941-36007963 TTTATAGTCTGGATGATTCACGG - Intronic
1110786830 13:79538331-79538353 ATAAGATTCTGGGGGACTCTTGG - Intronic
1111398686 13:87702771-87702793 AGTATTTTCAGGGGGAGTCAAGG - Intergenic
1115769014 14:36651357-36651379 ACTATATTCTGGGGAAGGCATGG + Intergenic
1116922255 14:50591381-50591403 TTTATTTTCTGTGGCATTCATGG + Intronic
1117530264 14:56654114-56654136 ATTACATTCTGGAGGGTTGAAGG - Intronic
1117942922 14:60988266-60988288 ATTAAAAGCTGGGGGGTTCAAGG - Intronic
1120699551 14:87683770-87683792 TTTATATCCTTGGGGACTCATGG - Intergenic
1122157332 14:99757783-99757805 ATTTTATTCAGGGAGCTTCATGG - Intronic
1122903467 14:104791527-104791549 ATGAGATGCTGGGGGAATCAGGG - Intronic
1123770971 15:23528293-23528315 CTTACATTCTGGGGAAATCAGGG + Intergenic
1124841123 15:33243132-33243154 TTTATTTTCTGTGTGATTCAGGG - Intergenic
1126819391 15:52487087-52487109 ATTATTTCCTGGGGGATGTATGG + Intronic
1126838945 15:52696880-52696902 ATTATATTCTGGGGGATTCATGG + Intronic
1128240592 15:66098583-66098605 ATGATATGCTGGAGGATTCTGGG - Intronic
1129494587 15:75966173-75966195 ATTCGATTCTGTGGCATTCAAGG + Intronic
1131085608 15:89573339-89573361 ATCACATTCTGGGGGATGCTGGG - Intergenic
1133058825 16:3161156-3161178 ATTTTTTTCTGGGGCAGTCAGGG + Intergenic
1136416705 16:30108540-30108562 AGGTTATTCTGGGGGATTCTGGG - Intronic
1137762700 16:50953404-50953426 ATTATATTCTGTGGTATTGGGGG - Intergenic
1138947170 16:61865263-61865285 ATTTTATTCTGGAGAATTTAGGG + Intronic
1144415180 17:15039608-15039630 CTGCTATTCTGGTGGATTCATGG - Intergenic
1146511229 17:33450485-33450507 GTCTTATTCTGGGGGATTCTGGG + Intronic
1146562700 17:33884781-33884803 ATTATATTCTTTGGGCTTCAGGG - Intronic
1148036603 17:44667914-44667936 ATTATATGATGGGAGATTTAAGG + Exonic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153596849 18:6734763-6734785 ACCATATTCTGGGGGATACTAGG + Intronic
1156521650 18:37726862-37726884 ATTATTTGCTGGGGGACTTATGG + Intergenic
1157813944 18:50717571-50717593 CTTATATTTTGTGGGATTCAGGG - Intronic
1157955629 18:52094462-52094484 ATTTTCTTCTAGGGGATTTATGG + Intergenic
1158494929 18:57946432-57946454 ATTATATTCTGAAGGTTGCATGG - Intergenic
1161868391 19:6851857-6851879 ATTAAACTTTGGGGGAGTCAAGG - Intronic
1164840332 19:31388209-31388231 TCTGTATTCCGGGGGATTCAGGG + Intergenic
1166896181 19:46023079-46023101 TTTATCTGCTGGGGGATTCCAGG + Intergenic
925866324 2:8230413-8230435 ATTATATTCTGGGATATTGATGG + Intergenic
927448154 2:23184014-23184036 ATTACATTATGAGGGCTTCATGG + Intergenic
928460189 2:31465243-31465265 ATTGAATTCTGGGGGACTCCAGG + Intergenic
934607302 2:95706356-95706378 ATTAAATTCAGTGGGATTAATGG + Intergenic
936540705 2:113348539-113348561 ATTAAATTCAGTGGGATTAATGG + Intergenic
937039559 2:118810437-118810459 ATTATAGGCTGTGGGATTTAGGG - Intergenic
937214488 2:120302946-120302968 ACTATGTTCTGGGGGATACCAGG - Intergenic
937723704 2:125133856-125133878 ATTATATTCTAGGGTTTTAAAGG - Intergenic
937847336 2:126595331-126595353 ATCAGTTTCTGGTGGATTCAGGG + Intergenic
941254982 2:163217605-163217627 AAAATATTCTGTGGGGTTCAAGG + Intergenic
941764771 2:169284823-169284845 ATGACATTCTGGGGGTTTGAGGG - Intronic
942271262 2:174277841-174277863 ATTTTACTCTGGGTGATTCTGGG + Intergenic
943938184 2:193953374-193953396 ATTAAATTCTGGGAGGTTCTAGG - Intergenic
947705659 2:232273541-232273563 ATTATTTGCTGGGGCATCCAGGG + Intronic
948021085 2:234733773-234733795 ATTATTTTTAGGGGAATTCAAGG + Intergenic
1174192453 20:48749953-48749975 ATAAGAGTCTGGGGGTTTCAGGG - Intronic
1174250446 20:49215682-49215704 ATTTTATTCTCGGAGACTCAAGG - Intergenic
1176419488 21:6502685-6502707 ATTATAGTCTGGGGTCTTCACGG - Intergenic
1177445408 21:21189147-21189169 ATTATTTTCTATGGGATTAAAGG - Intronic
1177462337 21:21429397-21429419 AGTATATTCTGGGGGATGAGAGG - Intronic
1177745732 21:25211073-25211095 ATAATAGTCTGGGAGTTTCAAGG - Intergenic
1178309212 21:31515686-31515708 ATTTTATTCTGCAGGATTCCTGG - Intronic
1179694981 21:43111008-43111030 ATTATAGTCTGGGGTCTTCACGG - Intergenic
1182807075 22:33081900-33081922 ATAAGATTCAGGGAGATTCAGGG + Intergenic
1182892954 22:33834099-33834121 ATTATATTCTTGGTGATAGAAGG - Intronic
1182919231 22:34064332-34064354 TTTTTATTCTTGGGGTTTCAGGG - Intergenic
1183375686 22:37463681-37463703 ACTACATTCTGGGGGGTTCAGGG - Intergenic
1184253015 22:43271637-43271659 AATGTAATCTGGGGGATACAGGG - Intronic
949344491 3:3064244-3064266 ATTCTATCCTGGGGGATCAATGG - Intergenic
951311203 3:21128199-21128221 TTTGTATTCTGTGGGATCCATGG - Intergenic
953310138 3:41869277-41869299 ATTATATTATGGGCTATACAGGG + Intronic
958179441 3:90040000-90040022 ATTATATTCATGATGATTCAGGG - Intergenic
958992058 3:100857854-100857876 ATTTTCTTCTAGGAGATTCAAGG - Intronic
960630534 3:119726106-119726128 ATTATATACTGGGGGGTGCATGG + Intronic
961167153 3:124771270-124771292 TTTTTTTTCTGGGGGTTTCAGGG - Intronic
969198034 4:5578720-5578742 ATAATAGATTGGGGGATTCAGGG + Intronic
972029563 4:34436525-34436547 ATTAAATTCTAGGTCATTCAAGG - Intergenic
974717274 4:65683966-65683988 ATTATATTCTGGCTGACCCAAGG - Intergenic
975469829 4:74752880-74752902 ATTATATGCTGTGGGATTGGTGG + Intronic
975926365 4:79459250-79459272 ACAATATTTTGGGGTATTCAAGG + Intergenic
978294940 4:107194081-107194103 ATCATATTCTAAGGGATGCAAGG + Intronic
979880578 4:125953303-125953325 ATTATATTCTGTGGTAAGCAGGG + Intergenic
981653029 4:147080300-147080322 TTTTTTTTCTGGGGGATTCTGGG + Intergenic
984260912 4:177442805-177442827 AGTATATTCTTGGGGATCCCAGG + Intergenic
984303877 4:177961979-177962001 ATTATATTCTAGATGCTTCATGG + Intronic
985324882 4:188755821-188755843 TCTTCATTCTGGGGGATTCATGG - Intergenic
987616908 5:20286564-20286586 CTTATTTTCTTGGGGATTCCAGG + Intronic
989250993 5:39314823-39314845 ATTAAGTTCTGTGGGATACAAGG - Intronic
990938053 5:61171906-61171928 ATAATAATGTGGGGGATACAGGG - Intergenic
990938240 5:61173358-61173380 ATTGTATCCTGGGGGAATGACGG + Intergenic
992213159 5:74500682-74500704 ATTATATTCTGGCGGCTGCATGG + Intergenic
995516440 5:112958997-112959019 ACTATGTTTTGGGGGAGTCAAGG - Intergenic
996242269 5:121218677-121218699 GTTATATTCTGAAGCATTCAGGG + Intergenic
997572446 5:134941421-134941443 ATTCTATACTTGGGGATTTATGG - Intronic
997973687 5:138425665-138425687 ATTATATTCTGGGGCATAATGGG + Intronic
998747163 5:145273777-145273799 ATTGTATCCTGGGAAATTCAGGG + Intergenic
1000394559 5:160760162-160760184 CTTATATTCTGAGGGTATCAAGG - Intronic
1000430486 5:161146600-161146622 TTTTTTTTCTGGAGGATTCAGGG + Intergenic
1003588061 6:7411429-7411451 ATTATCTTGTTGGGCATTCATGG - Exonic
1004084686 6:12434044-12434066 ATCATATTCTGGGCCATTTAAGG - Intergenic
1004389344 6:15197052-15197074 ATTATACTTTGGGGGACCCAGGG + Intergenic
1005099149 6:22150641-22150663 ATTATTTTCTGGGGTATTGTGGG + Intergenic
1005769681 6:29054817-29054839 TTTAGATTCAGGGGGATACATGG - Intergenic
1007197804 6:40077668-40077690 AGTAGATTCTGGGGGACTCAAGG + Intergenic
1007506559 6:42339839-42339861 ATTAAATTCTGGTGGCTCCAGGG - Intronic
1008183264 6:48360194-48360216 ATTATCTTCTAGGGGTTTTATGG - Intergenic
1008712617 6:54247097-54247119 AATATATTCTCAGGCATTCAAGG - Intronic
1009366988 6:62863687-62863709 ATAATATTTTGGGGGAAACAGGG - Intergenic
1009811344 6:68671145-68671167 ATTGTTTTCTGGGGGAATCTAGG + Intronic
1010277770 6:73989752-73989774 ATTATATTTTGGTGAAGTCAGGG - Intergenic
1014611307 6:123550725-123550747 ATTCCATTCTGAGGGATTCGTGG + Intronic
1015481366 6:133714399-133714421 TTTATATTACGGGGGATTGAGGG - Intergenic
1015684774 6:135847613-135847635 ATTATTTTCTGGAGGTTCCAGGG + Intergenic
1016774066 6:147884767-147884789 ATTTAATTCTGTGGCATTCATGG + Intergenic
1018276364 6:162136012-162136034 AATGTATTCTGGGGGACTCAGGG - Intronic
1028308730 7:89301581-89301603 ATAAAATTCTGGAGGATTCAAGG - Intronic
1029891070 7:103931131-103931153 ATGGGATTCTGGGGGATTCTTGG - Intronic
1030768644 7:113443859-113443881 TTTATATTCTGAGGCATACAAGG - Intergenic
1032337889 7:131043229-131043251 TTTATATATGGGGGGATTCAGGG + Intergenic
1033517732 7:142125934-142125956 ATTTGATTCTGGGTGATTCTGGG - Intronic
1045608646 8:103808876-103808898 ATAATATTTTGGGGTATTTATGG + Intronic
1047294266 8:123557404-123557426 ATTATGTTATGGGGAAATCATGG + Intergenic
1047871643 8:129089514-129089536 ATTCCATTCTGGGGGTTTCATGG + Intergenic
1051357017 9:16248779-16248801 CTAATTTTCTGGGAGATTCAAGG - Intronic
1058322246 9:103647571-103647593 ATTTTATTCTAGGGGATAGAGGG + Intergenic
1060078405 9:120617051-120617073 GTTATATTTTGGGGGGTTCCAGG - Intronic
1062728156 9:138090440-138090462 ATTTTATTCTAGTAGATTCATGG - Intronic
1188143459 X:26581217-26581239 ATTAAACACTGAGGGATTCATGG + Intergenic
1188190781 X:27169337-27169359 ATAACATTCTGGAGGCTTCAGGG - Intergenic
1189032689 X:37466447-37466469 ATGATTATTTGGGGGATTCAAGG - Intronic
1190377658 X:49805598-49805620 ATTTTAGTCTGAGGTATTCAGGG - Intergenic
1196108912 X:111925505-111925527 ATTGTATACTGTGGGAATCATGG + Intronic
1196719984 X:118844629-118844651 ATCAAAAACTGGGGGATTCATGG - Intergenic
1197916215 X:131538771-131538793 ATTATCTTCTGAGAGCTTCAGGG - Intergenic
1198764103 X:140063343-140063365 ATGATAGTCTCGGGGACTCATGG + Intergenic
1199322059 X:146451527-146451549 ATAACATTTTAGGGGATTCATGG - Intergenic