ID: 1126839094

View in Genome Browser
Species Human (GRCh38)
Location 15:52698368-52698390
Sequence CTGGATCATAAAGCAGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126839094 Original CRISPR CTGGATCATAAAGCAGATGC AGG (reversed) Intronic
900748196 1:4375745-4375767 CTGGGTCATAGAGAAGATGCAGG - Intergenic
903581755 1:24376319-24376341 CTGCATCAAAAACCAGGTGCAGG - Intronic
905493135 1:38361063-38361085 CTGGAGGTTCAAGCAGATGCTGG + Intergenic
906539306 1:46572843-46572865 TTGGATCAGAGATCAGATGCAGG - Intronic
906796721 1:48702190-48702212 CTGGCTCAGAAAGCAGAAGGCGG - Intronic
907304502 1:53506206-53506228 CTGAATCATAAAGCAGAACGAGG + Intergenic
907841167 1:58158809-58158831 CTGGATCCCAAAGCAAATGCAGG + Intronic
908214009 1:61932391-61932413 CTGGCTCATGGAGCAGGTGCTGG - Intronic
918633092 1:186742836-186742858 GTGGATAATAAAGCAGAGGTGGG - Intergenic
918960065 1:191263161-191263183 CTGGATCATAGGGGAGTTGCAGG + Intergenic
919981279 1:202644048-202644070 ATGGAACAAAAGGCAGATGCTGG + Intronic
922719231 1:227891870-227891892 CTGGGGCAGAAAGCAGGTGCAGG - Intergenic
923059655 1:230459188-230459210 CTGGGTCATAGGACAGATGCTGG + Intergenic
1063379361 10:5574749-5574771 CTGGATCATGAACCAGGTGCAGG - Intergenic
1063956075 10:11268484-11268506 CTGGATCATAAAGCAGAACTGGG + Intronic
1067717865 10:48703768-48703790 CTGGAGCATGAAGCAACTGCTGG - Intronic
1067730564 10:48807887-48807909 CTGGCTCAGAAACCAGTTGCTGG + Exonic
1069978678 10:72236897-72236919 CTGGACTTTAAAGCTGATGCTGG - Intergenic
1070416470 10:76194745-76194767 CTGGATCATCAAGCACATATTGG - Intronic
1071539587 10:86468492-86468514 CTGTATCATAAAGAATAGGCTGG - Intronic
1071727887 10:88218208-88218230 CTCCATGCTAAAGCAGATGCTGG + Intergenic
1075663612 10:124215338-124215360 CTGGAACATAGATGAGATGCTGG + Intergenic
1079407831 11:20161040-20161062 CTGAAGCATAAAGCAAATGTAGG + Intergenic
1080269070 11:30431586-30431608 CAGAATGATAAAGCAGATGGTGG + Intronic
1080329564 11:31120119-31120141 CTGGATGATGAACTAGATGCTGG + Intronic
1080964062 11:37194191-37194213 TTGAAACATTAAGCAGATGCTGG + Intergenic
1083576155 11:63793293-63793315 CTGGCCCATAAAGCAGAAGGAGG + Intergenic
1085132924 11:74057354-74057376 TTGGAACAAAAAGCAGATTCTGG + Intronic
1088798045 11:113281246-113281268 CTGGAACAGAAAGCAAATGATGG + Intergenic
1090099465 11:123778835-123778857 CTAGATCTTAAAGCAGCTTCAGG + Intergenic
1090306592 11:125696559-125696581 CTGGACCAGAAAGCAGCTGCTGG - Intergenic
1092040263 12:5378125-5378147 CAGGCTCACAAAGCAGATGTTGG - Intergenic
1092944659 12:13441543-13441565 CTGGTTCTTACAACAGATGCAGG - Intergenic
1095579545 12:43781076-43781098 CTGGATCAGAAAGGAAATGTGGG - Intronic
1100253998 12:92862774-92862796 CTTTATGATAAATCAGATGCGGG + Intronic
1100308597 12:93374014-93374036 CTGCCTCATAAGGCTGATGCTGG + Intergenic
1101058137 12:100940994-100941016 CTGGTTCATAAATCAGATGGTGG - Intronic
1102035640 12:109769186-109769208 CTGCATCAAGGAGCAGATGCTGG + Exonic
1102168856 12:110826909-110826931 CTGGATCATGAAACAGAGGCCGG + Intergenic
1102187438 12:110959880-110959902 CTCGAGGATAAAGCAGATGAGGG + Intergenic
1102503762 12:113371191-113371213 CTGGATCCTAAGGCACATGCAGG - Intronic
1104164348 12:126213029-126213051 CTGCATAATTAAGCAGACGCTGG + Intergenic
1105679561 13:22712580-22712602 TTGTATTATAAAGCAAATGCAGG - Intergenic
1107851168 13:44575227-44575249 CTGGATGATACAGCAGAAGTTGG + Exonic
1107949880 13:45452380-45452402 CAGGATCAAAAAGAAGATGATGG - Intergenic
1109384871 13:61614636-61614658 CTGGATCACAAAGCAGGACCTGG + Intergenic
1109777048 13:67054829-67054851 CTGGATAATATGACAGATGCAGG - Intronic
1115420701 14:33191668-33191690 GTGGATCATAAAGCAGAATTTGG + Intronic
1115472329 14:33780905-33780927 CTGAATCATAAAGCAATAGCCGG - Intronic
1116201659 14:41805042-41805064 GTGAATCAAAAAGCAGATGGAGG + Intronic
1120465457 14:84851014-84851036 TGGTATCATAAAGCATATGCAGG - Intergenic
1120549240 14:85848841-85848863 TTGAAACATACAGCAGATGCTGG + Intergenic
1122762728 14:104041794-104041816 CTGGGTCATATGGTAGATGCAGG - Intronic
1124496981 15:30192783-30192805 GTGGAACAAAAGGCAGATGCTGG + Intergenic
1124746595 15:32345864-32345886 GTGGAACAAAAGGCAGATGCTGG - Intergenic
1125289549 15:38130657-38130679 CTTTATCATAAAACACATGCAGG - Intergenic
1126839094 15:52698368-52698390 CTGGATCATAAAGCAGATGCAGG - Intronic
1128796055 15:70467490-70467512 CTGGACCATAATGCAGCTGGAGG + Intergenic
1129007910 15:72389848-72389870 CAGGAGAATGAAGCAGATGCAGG - Intergenic
1129291809 15:74574046-74574068 GTGCATTATAAAGCAGATGCCGG - Intronic
1130394417 15:83489637-83489659 CAAGATCACAAAGCAGAAGCAGG - Intronic
1131433570 15:92405639-92405661 CAGGACCAAAAAGCAGATACAGG + Intronic
1133211625 16:4266307-4266329 CTGGCTCAGAAACCAGCTGCTGG + Intronic
1136267902 16:29131702-29131724 CTCCATCAAAAAGCAGACGCAGG - Intergenic
1138835636 16:60431151-60431173 CTGGATCATGAAACAGATAAAGG + Intergenic
1141353017 16:83316494-83316516 CTGGCTCCTAAAGCAGAAGTGGG + Intronic
1151471102 17:74318299-74318321 GTGGAGAATAAACCAGATGCAGG + Intergenic
1157339275 18:46764899-46764921 CTGGATCATAGAGGACATGCGGG - Intergenic
1158528518 18:58236656-58236678 CAGGATCATTAAGCAGCTTCTGG - Intronic
1162970971 19:14181310-14181332 CTGGTTCAGAATGCAGATTCGGG + Intronic
1163373336 19:16914707-16914729 CTGGATCATCCAGCAGCAGCAGG - Exonic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
930948616 2:57108880-57108902 CTGGTTGATAAAGCAGTGGCAGG - Intergenic
931737411 2:65209053-65209075 GTGGATAATAATGCAGATGCTGG + Intergenic
932771082 2:74501199-74501221 CTGGATCAAAGAGCAGAGCCAGG + Intronic
933691486 2:85182408-85182430 CAGGATCAGAGAGCAGCTGCTGG - Intronic
935351469 2:102154862-102154884 CTGGAGCATAAACCAGAGGTGGG - Intronic
935846700 2:107173755-107173777 CTGGACCATGAAGCAGATTTTGG - Intergenic
935890790 2:107675480-107675502 CTGGAGCAGAAGCCAGATGCTGG - Intergenic
939954129 2:148511215-148511237 CTGGCTCATAAAACCTATGCTGG - Intronic
940841862 2:158592999-158593021 CTTGTAAATAAAGCAGATGCTGG - Intronic
943162139 2:184268260-184268282 CTGGGTCATAAACCACATACAGG - Intergenic
946848735 2:223884674-223884696 CTGGAACATAAAGCAGATGTGGG - Exonic
1168841220 20:911275-911297 CTGGAGCAAACAGCAGAGGCTGG + Intronic
1169339476 20:4785437-4785459 CTGGAGAATAAAGCCGCTGCTGG - Intronic
1171294627 20:24006462-24006484 GTGGATCTATAAGCAGATGCTGG - Intergenic
1172559018 20:35869196-35869218 CTGGATCATAGAAAAGATTCAGG + Intronic
1174568590 20:51484816-51484838 CTGGGTCAGAAAGCAGGCGCAGG - Intronic
1177539181 21:22469324-22469346 CTTGATAGTAATGCAGATGCAGG - Intergenic
1178336958 21:31751849-31751871 CTGTATTATTAAGCACATGCTGG + Intergenic
1178550240 21:33531641-33531663 CTGGTTCATAATACAAATGCTGG - Intronic
1178744133 21:35231154-35231176 CTGCTTCAAAAAGCAGATGATGG + Intronic
1179098032 21:38333023-38333045 CTTGATCATACAGCAGCTTCTGG - Intergenic
1180014081 21:45071737-45071759 CTGGAAAATAAACCTGATGCTGG - Intergenic
1181362698 22:22350520-22350542 ATAGATCATAAAGCAAATTCTGG + Intergenic
1181564519 22:23726811-23726833 CTGGGTCATACAGCAGGGGCTGG - Intergenic
949948453 3:9208780-9208802 CAACATCATACAGCAGATGCTGG - Intronic
951595949 3:24318295-24318317 CTGGAGCATAAGGCACATGCAGG - Intronic
961308441 3:125976222-125976244 CTGGATCATAAAGCAGGGTTTGG - Intronic
961373592 3:126448031-126448053 CTGGATGAGAAAGCTGAGGCAGG - Intronic
961614078 3:128164907-128164929 CTGGGTCAGAAAGCTGAAGCTGG - Intronic
965782667 3:172304292-172304314 CTGGATAATAGAGCAGAGGGAGG - Intronic
966876533 3:184325330-184325352 CTGCAGCATAAAGCGGATGCGGG - Exonic
967610438 3:191499684-191499706 CTGCCTCATACAGCAGAAGCTGG - Intergenic
969983168 4:11179761-11179783 CTGGACCATCAACCTGATGCTGG + Intergenic
977784414 4:101016010-101016032 CTGAATCATGAAGCACATGCTGG + Intergenic
979885460 4:126022517-126022539 CTGGATCAGAATGCAGATTAAGG + Intergenic
982395559 4:154911759-154911781 CTGGATCATAAAGCTGCTCTCGG + Intergenic
982876146 4:160652778-160652800 CTAGTTGATAAAGCAGCTGCAGG + Intergenic
986908922 5:12530392-12530414 TTGCCTCATAAAGCAGATGGTGG + Intergenic
990420390 5:55626100-55626122 CTGAAACATAAAACAGAAGCAGG + Exonic
996748858 5:126869201-126869223 TTGGAACACAAGGCAGATGCTGG + Exonic
997082883 5:130761633-130761655 CTGGATCATAAACTTGAGGCAGG + Intergenic
997389613 5:133503453-133503475 CGGGATCATAAAGCAAATGGAGG + Intronic
997722289 5:136088791-136088813 CTGGATAAGGAAGCAGAGGCTGG + Intergenic
998110938 5:139502156-139502178 CATGATCAAAAAGCTGATGCTGG + Intergenic
1001309442 5:170600413-170600435 CTGGATCTTAAAGGACAAGCTGG - Intronic
1004161320 6:13215863-13215885 CTGGATGATCAACTAGATGCAGG + Intronic
1004393423 6:15227976-15227998 GTGGATCAGAGATCAGATGCAGG + Intergenic
1004476537 6:15978652-15978674 CTGGAAATTAAAGCAGAGGCTGG - Intergenic
1005463948 6:26093651-26093673 CTGGATCTTGAAGGAGAAGCTGG + Intronic
1006187821 6:32190627-32190649 CTGGCTCATTAAGCAGCGGCTGG - Intergenic
1006848332 6:37078948-37078970 CTGAATCATCAAGCAGAGACTGG + Intergenic
1007205863 6:40150078-40150100 CTGGAGCAGAAAGCAAATGTCGG - Intergenic
1009465207 6:63960478-63960500 CTGGTTGATAAAGCAGTGGCAGG + Intronic
1010061017 6:71623470-71623492 ATGGATCATAAGGGAGATACAGG - Intergenic
1011935575 6:92772442-92772464 TTGGTTCATAAAACAGAGGCAGG - Intergenic
1013111857 6:107070600-107070622 CTGGATCAGGAAGTAGATGTTGG + Exonic
1014348921 6:120314165-120314187 CTGAGGAATAAAGCAGATGCTGG - Intergenic
1019766795 7:2857492-2857514 CTAGATAATAAAGCAGCTCCTGG - Intergenic
1021075310 7:16297033-16297055 CTGCCTGCTAAAGCAGATGCTGG - Intronic
1021837916 7:24698792-24698814 CTGGAACCTAACTCAGATGCTGG + Exonic
1022415157 7:30171211-30171233 CTGGATCATAAACCTAATGAAGG + Intergenic
1023029409 7:36079486-36079508 CTGGATCAGGCAGCAGGTGCAGG + Intronic
1028340693 7:89716298-89716320 CTGGATCATTGAGGATATGCGGG - Intergenic
1028776186 7:94679934-94679956 CTGGAGCATCAAGGAGATGTAGG - Intergenic
1029710940 7:102299568-102299590 GGGGACCATAAAGCAGCTGCTGG + Intronic
1031452470 7:121938622-121938644 CTGGATCATAAAGCTGACAAAGG + Intronic
1034750328 7:153562244-153562266 TTAGATCATAAACCAGGTGCCGG - Intergenic
1038114746 8:24540803-24540825 CTAGATCACAAAGCAGTTGTAGG - Intergenic
1038522740 8:28247358-28247380 CTGGCTCAGGAAGCACATGCCGG - Intergenic
1043804905 8:84659404-84659426 CTGGATCAGACATCAGATGAGGG + Intronic
1044931719 8:97258200-97258222 GTGGATCAAAAAGCAGATATTGG - Intergenic
1045906818 8:107355540-107355562 CTGGAGCATAAAGTACATGTAGG - Intronic
1046783696 8:118242977-118242999 CTGGATCATAGAGCAGGTGAGGG - Intronic
1047353302 8:124096397-124096419 CTAGAGCATGAAGAAGATGCAGG - Intronic
1050060827 9:1707967-1707989 CTGCTTCATAAAGCAGTTTCAGG - Intergenic
1052166526 9:25337196-25337218 CTGGATCATACAGTACAGGCAGG - Intergenic
1053473374 9:38363416-38363438 CCGCATCATGAAGCAGCTGCCGG - Intergenic
1053603253 9:39631631-39631653 CCAGATCATAAGGCAGATCCAGG - Intergenic
1053860886 9:42385352-42385374 CGAGATCATAAGGCAGATCCAGG - Intergenic
1054250285 9:62710794-62710816 CCAGATCATAAGGCAGATCCAGG + Intergenic
1054564393 9:66745322-66745344 CCAGATCATAAGGCAGATCCAGG + Intergenic
1055105182 9:72504774-72504796 CTGGAGCATAAAGCTGAAGAGGG + Intergenic
1058404785 9:104660380-104660402 CTGGTTCGTAAGGCAGATGTTGG + Intergenic
1059387602 9:113976948-113976970 GGGGATGACAAAGCAGATGCAGG - Intronic
1061076566 9:128345049-128345071 CTGGCTCATGAAGCATAGGCTGG + Intronic
1062193625 9:135260482-135260504 CTGGGTCATATTGCAGCTGCAGG - Intergenic
1190283090 X:48944220-48944242 CTTCATCATCAAGCAGATGAAGG - Exonic
1192446130 X:71212793-71212815 GTGGGTCATAAAGGAGATGGAGG - Intergenic
1194607010 X:95993005-95993027 CTGGACCATAAAGGATATGTAGG + Intergenic
1198647815 X:138828785-138828807 CTGTTTTATAAAGCAGATGGCGG - Intronic
1199947801 X:152681806-152681828 CTGGACCAGAAGGCAGATGGAGG + Intergenic
1199961878 X:152786648-152786670 CTGGACCAGAAGGCAGATGGAGG - Intergenic
1201621048 Y:15958119-15958141 TTGGTTCATAAAGGAGTTGCTGG + Intergenic