ID: 1126844993

View in Genome Browser
Species Human (GRCh38)
Location 15:52751189-52751211
Sequence GGGAAAGTATTTACATCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126844987_1126844993 20 Left 1126844987 15:52751146-52751168 CCCTGTGGGAGGGAAAGAGAAAG No data
Right 1126844993 15:52751189-52751211 GGGAAAGTATTTACATCTATGGG No data
1126844988_1126844993 19 Left 1126844988 15:52751147-52751169 CCTGTGGGAGGGAAAGAGAAAGG No data
Right 1126844993 15:52751189-52751211 GGGAAAGTATTTACATCTATGGG No data
1126844984_1126844993 30 Left 1126844984 15:52751136-52751158 CCACAGTCACCCCTGTGGGAGGG No data
Right 1126844993 15:52751189-52751211 GGGAAAGTATTTACATCTATGGG No data
1126844986_1126844993 21 Left 1126844986 15:52751145-52751167 CCCCTGTGGGAGGGAAAGAGAAA No data
Right 1126844993 15:52751189-52751211 GGGAAAGTATTTACATCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126844993 Original CRISPR GGGAAAGTATTTACATCTAT GGG Intergenic
No off target data available for this crispr