ID: 1126845599

View in Genome Browser
Species Human (GRCh38)
Location 15:52757970-52757992
Sequence CTTTAAGCACCATTGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126845595_1126845599 2 Left 1126845595 15:52757945-52757967 CCTGCTTTCTGTTTGCTGACCTC 0: 1
1: 0
2: 1
3: 33
4: 270
Right 1126845599 15:52757970-52757992 CTTTAAGCACCATTGGAGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 106
1126845594_1126845599 10 Left 1126845594 15:52757937-52757959 CCTCATGGCCTGCTTTCTGTTTG 0: 1
1: 0
2: 1
3: 35
4: 331
Right 1126845599 15:52757970-52757992 CTTTAAGCACCATTGGAGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 106
1126845593_1126845599 15 Left 1126845593 15:52757932-52757954 CCATTCCTCATGGCCTGCTTTCT 0: 1
1: 0
2: 1
3: 77
4: 677
Right 1126845599 15:52757970-52757992 CTTTAAGCACCATTGGAGGCTGG 0: 1
1: 0
2: 1
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126845599 Original CRISPR CTTTAAGCACCATTGGAGGC TGG Intronic
900393811 1:2444952-2444974 ATTCAGGCACCATGGGAGGCCGG + Intronic
900763697 1:4489387-4489409 CTCTAAGCACCACGGGAGGGAGG + Intergenic
904263603 1:29305190-29305212 CTCTGGGCACCATGGGAGGCAGG - Intronic
910287907 1:85575459-85575481 CTTTAAGCACCTTGGCAGGCTGG - Intronic
923227474 1:231951767-231951789 ATTTAAGGAACATTAGAGGCAGG + Intronic
923754432 1:236777856-236777878 CTTTAATCAACATGGGAGTCAGG - Intergenic
1067177794 10:43962426-43962448 CTTTCAGCGCCTTTGGAGCCTGG + Intergenic
1074788455 10:116863024-116863046 TGTTAAGTACCATTAGAGGCTGG - Intronic
1076673227 10:132134512-132134534 TTAGAAGCCCCATTGGAGGCAGG + Intronic
1081491357 11:43571749-43571771 TTTTAAGGACCACTGGATGCTGG - Intronic
1083449963 11:62736899-62736921 CTTTAAGAGTGATTGGAGGCTGG + Intronic
1085319900 11:75567635-75567657 CTTAAAGCAACCTTGGGGGCAGG + Intronic
1087649439 11:100847449-100847471 CTTTAAGGACCCTTGGATACTGG + Intronic
1088666973 11:112102783-112102805 CATTAAAGACCATTTGAGGCTGG - Intronic
1089816922 11:121184086-121184108 CTTTAAGAATTATTGTAGGCTGG - Intronic
1090466704 11:126941516-126941538 GTTTATGCACCATGCGAGGCTGG - Intronic
1099474527 12:83092263-83092285 CTTTAAGCTCTATGTGAGGCTGG - Intronic
1101600594 12:106206138-106206160 CTTTAAGCCTCATTGAATGCGGG - Intergenic
1102138073 12:110591890-110591912 CTTTAAGCAACACTTGCGGCTGG + Intergenic
1114147542 14:19994646-19994668 CTTTAAACAGAATGGGAGGCAGG - Intergenic
1121106133 14:91281184-91281206 CTTCAAGCACCCTTCCAGGCTGG - Intronic
1126845599 15:52757970-52757992 CTTTAAGCACCATTGGAGGCTGG + Intronic
1135540870 16:23329539-23329561 TTTTAAGCACCCTCGGAGGTAGG + Intronic
1141816904 16:86417084-86417106 CTTTTTGCACCATCAGAGGCAGG + Intergenic
1144378716 17:14671453-14671475 ATTTCAACACCAGTGGAGGCTGG - Intergenic
1145944394 17:28762123-28762145 ATTTCAGCATCAGTGGAGGCAGG - Intronic
1149373373 17:56019196-56019218 CTTTAAAAACCAGTGGAGGCCGG + Intergenic
1156651602 18:39233119-39233141 CTTGATGCACCACTGGAGGGAGG + Intergenic
1159112415 18:64074652-64074674 ATTAAAGAACCACTGGAGGCCGG + Intergenic
1159445502 18:68537329-68537351 GTTTAAGCACCACTGGATGAGGG + Intergenic
1159445703 18:68539508-68539530 GTTTAAGCACCACTGGATGAGGG + Intergenic
1159445903 18:68541685-68541707 GTTTAAGCACCACTGGATGAGGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165578172 19:36839042-36839064 CTTTAAGGGCGATTGGAGGATGG - Intronic
925213889 2:2075588-2075610 CTGTAAGAATCATTGGAGGAGGG + Intronic
925931027 2:8708075-8708097 CTCTGAGCAACACTGGAGGCTGG - Intergenic
930495103 2:52131468-52131490 CTTTAAACAGAATGGGAGGCAGG - Intergenic
933943198 2:87262239-87262261 CTTCAAGCATGATTAGAGGCTGG - Intergenic
934115344 2:88785376-88785398 CTTTAGGAACCAGTGGAAGCAGG + Intergenic
934628237 2:95883567-95883589 CTTTAGGAACCAATGGAAGCAGG - Intronic
934832192 2:97539426-97539448 CTTTAGGAACCAGTGGAAGCAGG - Intronic
935955411 2:108371766-108371788 TTTTAAGTACCATTGCAGGCTGG + Intergenic
936337014 2:111599324-111599346 CTTCAAGCATGATTAGAGGCTGG + Intergenic
939566626 2:143793261-143793283 GTTTCAGTACCTTTGGAGGCAGG - Intergenic
940459587 2:153947259-153947281 CTTTAAGCTCCATGGCAGGTGGG - Intronic
942146349 2:173031068-173031090 CTTTAAGCACCATTGCAAGTTGG - Intronic
947104211 2:226651189-226651211 GTTTAAGCACCATTGTAGGTGGG - Intergenic
1169257237 20:4108889-4108911 CTTACAGCAACACTGGAGGCCGG - Intergenic
1169897880 20:10523582-10523604 CTGTAAGCACCATAGAAGACAGG + Intronic
1172134397 20:32677236-32677258 GATTAAGAACCATTTGAGGCCGG - Intergenic
1178244336 21:30936493-30936515 CTTTGGGCACCAATGGAGGGAGG + Intergenic
1179976648 21:44872285-44872307 CCCTAAGCACACTTGGAGGCAGG + Intronic
1184884078 22:47331547-47331569 CATTAAGCACCATGGAAGCCGGG + Intergenic
1184932289 22:47690360-47690382 TTTTAAGGACCATTGATGGCTGG + Intergenic
949210002 3:1486630-1486652 CTTAAGACACCATTGGAGTCAGG + Intergenic
950383527 3:12637573-12637595 CTTAAAACACAAATGGAGGCCGG + Intronic
951527241 3:23665244-23665266 GTTTAAGAACCACTGGCGGCTGG - Intergenic
956188682 3:66586926-66586948 CTTCCATCACCATAGGAGGCAGG + Intergenic
959855796 3:111156162-111156184 CTTTAAGCACCAGTGAAGGCTGG - Intronic
963384066 3:144568514-144568536 CTTTTAAAACCATCGGAGGCTGG + Intergenic
964688103 3:159419949-159419971 ATTTAAGGACCATTTGAGGAAGG + Intronic
968799729 4:2733949-2733971 CTATAAGCACCCTGGGATGCTGG - Intergenic
970386798 4:15564436-15564458 TTTCAAGCACCATGGTAGGCAGG + Intronic
971275303 4:25191127-25191149 CTTTAAGAACTATTAAAGGCCGG + Intronic
972866068 4:43234776-43234798 TGCTAAGCACCATTGTAGGCAGG - Intergenic
972866774 4:43242598-43242620 TATTAAGTACCATTGTAGGCAGG - Intergenic
972925672 4:44003145-44003167 CCTTATGCAGCATTGAAGGCAGG + Intergenic
975621626 4:76302659-76302681 ATTTAAGCACGATTGGGAGCAGG - Intronic
976191542 4:82491626-82491648 CTTTCAGCACCTTTGGCAGCAGG + Intronic
976820773 4:89204310-89204332 CTTTAAGCACATTTGGAGTAAGG + Intergenic
979673612 4:123386764-123386786 ATTTAAGGACTATTTGAGGCAGG + Intergenic
980529385 4:134031671-134031693 CTCATAGCTCCATTGGAGGCTGG + Intergenic
981083834 4:140662299-140662321 CTTTCAGCTCCATAGTAGGCTGG + Intronic
982480044 4:155897801-155897823 CTTTAAGAAACATTTCAGGCCGG - Intronic
984011481 4:174376718-174376740 CTTTAAGGAGCAGGGGAGGCTGG + Intergenic
988409561 5:30869738-30869760 CTATAAGCAGCTTTGGAGGTAGG + Intergenic
989135312 5:38148272-38148294 CTTTGTGCACTATTGAAGGCAGG + Intergenic
992323594 5:75638235-75638257 CTTTTAGCAACTTTGGAGTCAGG + Intronic
993975097 5:94469466-94469488 CTTTAAGACCCATTTGAGGCCGG - Intronic
994943836 5:106359751-106359773 ATTTCACTACCATTGGAGGCAGG + Intergenic
1001337561 5:170812341-170812363 CTTGTAGCACCATTGGATGTGGG - Exonic
1004109237 6:12698970-12698992 CTTTAAGAAACATTCGAGGCCGG - Intergenic
1004909672 6:20270836-20270858 CTGTATACACCCTTGGAGGCTGG - Intergenic
1007830040 6:44630852-44630874 CTATAAGCTCCATAGGAGGGTGG + Intergenic
1013631338 6:111989049-111989071 CTTTAAGCACTAGTGGAAGAAGG + Intergenic
1013992243 6:116266315-116266337 CTTTAAGAGCCATTTGAGGAAGG + Intronic
1014438341 6:121445389-121445411 CTATAAGCACTTTGGGAGGCGGG - Intronic
1015316701 6:131824762-131824784 TTTTAAGAGCAATTGGAGGCCGG + Intronic
1016807515 6:148226939-148226961 CCTTAAGCTCCATTGGGGGTGGG + Intergenic
1017196598 6:151707061-151707083 GTTGAAGGAGCATTGGAGGCAGG + Intronic
1023356411 7:39371473-39371495 CTTTAAGAACCATTCTCGGCCGG - Intronic
1025075528 7:55939496-55939518 CTGTAAGCAACATCTGAGGCTGG - Exonic
1031403670 7:121356652-121356674 CCTAAAGCAGCATTGGAGCCTGG - Intronic
1032965365 7:137091282-137091304 CTTTAGGTGCCAATGGAGGCTGG + Intergenic
1033302930 7:140202207-140202229 CTTTGAGCCCAATTGGAGGAGGG - Intergenic
1035750432 8:1992252-1992274 CTTCAAACACCCTGGGAGGCAGG - Intronic
1043178547 8:77053460-77053482 ATTTAAGGACCATTGGTGGAAGG + Intergenic
1043231564 8:77808643-77808665 CTGCAGGCACCATTTGAGGCAGG - Intergenic
1043762699 8:84088714-84088736 CCTTAGTCACCATTGGAGACTGG - Intergenic
1046598533 8:116289852-116289874 CATTAATCACCATGGGAGTCTGG + Intergenic
1046891058 8:119421303-119421325 CTTTAAGAACCACTGTCGGCCGG - Intronic
1048549746 8:135423348-135423370 CTTTAAGCACTATTTTAGGTAGG + Intergenic
1051895054 9:21977660-21977682 CATTAAGAACCACTGTAGGCCGG - Intronic
1056826103 9:89877378-89877400 CTCCATGCACCATTGCAGGCTGG + Intergenic
1057215352 9:93224837-93224859 CTTTAAGCACCGTGTGAGTCTGG + Intronic
1058157795 9:101534283-101534305 CTTTGAGCACCCTGGGAGGTAGG + Intronic
1060142749 9:121224625-121224647 CTAAAAGCAACATTGGTGGCAGG - Intronic
1061819122 9:133214785-133214807 TTTTAAGCACATTTTGAGGCTGG + Intergenic
1062241563 9:135543402-135543424 TTTTAAGCACATTTTGAGGCTGG - Intergenic
1185577971 X:1188574-1188596 CTTTGAGTACAATGGGAGGCAGG + Intronic
1185787704 X:2904702-2904724 CTTTAAGCTCCCTGGGAAGCAGG - Exonic
1186799671 X:13080050-13080072 CTTTAATCACCAATGGAAGGGGG + Intergenic
1189125934 X:38446248-38446270 CCTTAAAAACCATTGCAGGCTGG - Intronic
1195686771 X:107594583-107594605 CTTTAAGAACTATTTTAGGCCGG + Intronic
1199166826 X:144686238-144686260 CTTTAAGCAGAATGGGAGGCAGG - Intergenic
1201396255 Y:13552356-13552378 CCTTAATCATCTTTGGAGGCAGG + Intergenic