ID: 1126845730

View in Genome Browser
Species Human (GRCh38)
Location 15:52759064-52759086
Sequence GCCACTGCCACCTTTATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126845726_1126845730 2 Left 1126845726 15:52759039-52759061 CCCCCTATGTAGGCGTTCTAGAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1126845730 15:52759064-52759086 GCCACTGCCACCTTTATATCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
1126845725_1126845730 10 Left 1126845725 15:52759031-52759053 CCTCTTAGCCCCCTATGTAGGCG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1126845730 15:52759064-52759086 GCCACTGCCACCTTTATATCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
1126845727_1126845730 1 Left 1126845727 15:52759040-52759062 CCCCTATGTAGGCGTTCTAGAGC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1126845730 15:52759064-52759086 GCCACTGCCACCTTTATATCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
1126845729_1126845730 -1 Left 1126845729 15:52759042-52759064 CCTATGTAGGCGTTCTAGAGCAG 0: 1
1: 0
2: 0
3: 7
4: 38
Right 1126845730 15:52759064-52759086 GCCACTGCCACCTTTATATCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
1126845728_1126845730 0 Left 1126845728 15:52759041-52759063 CCCTATGTAGGCGTTCTAGAGCA 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1126845730 15:52759064-52759086 GCCACTGCCACCTTTATATCTGG 0: 1
1: 0
2: 0
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126845730 Original CRISPR GCCACTGCCACCTTTATATC TGG Intronic
900162704 1:1231967-1231989 GCCACTGCCATCTTTCTTGCGGG + Exonic
901089704 1:6633090-6633112 GCCACTGCCACCTCTGCGTCCGG - Exonic
902842296 1:19082655-19082677 GCCAGTGCCACCTATAGACCTGG - Intronic
904714119 1:32454013-32454035 GTAGCTGCCACCCTTATATCTGG + Intergenic
905091818 1:35436194-35436216 GGCACTGCCACCCTTAAGTCAGG - Intronic
907185825 1:52608312-52608334 GCCCCTACCACCTTTCCATCTGG - Exonic
907579355 1:55557720-55557742 GCAACTGCAACATTTATATAGGG - Intergenic
908319602 1:62967048-62967070 GTCACTGCCACCTTTTCATATGG + Intergenic
916500432 1:165382608-165382630 TCCACTGTCACCTCAATATCAGG - Intergenic
916610011 1:166382472-166382494 GCCATTCCTACCTTAATATCTGG - Intergenic
919655465 1:200193137-200193159 GCATCTGCCACTTATATATCTGG + Intergenic
921069405 1:211646398-211646420 ACCATTGCCACCTTGAGATCAGG + Intergenic
923660403 1:235952210-235952232 GCCCCTGCCACCTTATTATTTGG - Intergenic
1066459950 10:35604487-35604509 GCTGCAGCCACCTTCATATCTGG - Intergenic
1072162839 10:92784389-92784411 CTCACTGCAGCCTTTATATCTGG + Intergenic
1072219476 10:93315587-93315609 GAACCTCCCACCTTTATATCTGG - Intronic
1073663360 10:105502653-105502675 GCCATTACCATCTTTATTTCAGG + Intergenic
1076206580 10:128609170-128609192 CCCACTGCAGCCTTGATATCTGG - Intergenic
1077126924 11:943979-944001 TCCACTGCCACCTGCATCTCCGG - Intronic
1077126932 11:944027-944049 TCCACTGCCACCTGCATCTCCGG - Intronic
1080911004 11:36598654-36598676 CCCTCTACCAACTTTATATCAGG + Intronic
1087173141 11:95070705-95070727 GCCATTGTCACCTTTCTTTCTGG - Exonic
1087895610 11:103582512-103582534 GCCACTTCCACCTTTTTTACAGG - Intergenic
1088193301 11:107249994-107250016 GCCACTCTCCCCTTTATTTCAGG - Intergenic
1090684107 11:129096538-129096560 GCCCCTGCCACCCCTATAGCAGG + Intronic
1093463040 12:19423555-19423577 GCCCCTGCGACCTTGATATCAGG - Intronic
1093774978 12:23063275-23063297 GCTACTGCACCCTTAATATCAGG + Intergenic
1094174235 12:27524995-27525017 TCAGCTGCCAGCTTTATATCTGG + Intronic
1095832739 12:46604626-46604648 GCTACTGCTACCATTATAGCCGG + Intergenic
1098992047 12:77074278-77074300 GCCACTGCCACCATCATAGAGGG - Intergenic
1105057105 12:133112072-133112094 GCCCCTGCCTCCTTTCAATCTGG + Exonic
1105443598 13:20434881-20434903 GCCACTGCCACCCTCAGCTCAGG + Intronic
1106447895 13:29852527-29852549 ACCACTGCCACCTTTACAAAAGG + Intergenic
1108488229 13:50950352-50950374 GCCACCACCACCTTTATACAGGG - Intronic
1112198466 13:97250371-97250393 CCAACTGCCACTTTTATTTCGGG + Intronic
1117832922 14:59770930-59770952 GCCTCAGCCTCCTTTATAGCTGG - Intronic
1118227953 14:63920698-63920720 TCCACGGCCACCTCTACATCAGG - Intronic
1118436538 14:65776265-65776287 CCCTCTGACACCTTTACATCTGG + Intergenic
1121087737 14:91159330-91159352 GCCTCAGCCACCTGAATATCTGG - Intronic
1121183316 14:91945865-91945887 GCCATGGCCAGATTTATATCTGG + Intronic
1122213581 14:100188786-100188808 GCCCGTGCCACCATTGTATCTGG + Intergenic
1126845730 15:52759064-52759086 GCCACTGCCACCTTTATATCTGG + Intronic
1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG + Exonic
1130054898 15:80514090-80514112 GCCACTGCCACCCTGATGTCTGG - Intronic
1130638229 15:85645556-85645578 GCATCTGCCACGTTTATATTAGG - Intronic
1132058899 15:98674449-98674471 TCCATTGCCTCCTTTATATGAGG + Intronic
1135172908 16:20202322-20202344 GCCTCAGCCACCTATATAGCTGG + Intergenic
1137407656 16:48202782-48202804 GGCAATGCCACTTTTATCTCGGG + Intronic
1137765536 16:50975037-50975059 GCCACTCCCACCTTCCTTTCTGG - Intergenic
1138461651 16:57151941-57151963 CCTACTGCCACCTCTATATGGGG - Intergenic
1138546654 16:57723432-57723454 GGCACTGCCTCCTTTAAATGTGG - Intronic
1140268204 16:73438906-73438928 GCCTCTGTCACCTTTGTCTCTGG - Intergenic
1141137991 16:81478976-81478998 GCACCTGCCACCTTTAAGTCTGG + Intronic
1142779194 17:2167603-2167625 GCCACTCACATCTTTATATATGG + Intronic
1150066184 17:62111362-62111384 GCCACTGCCTCCTTTCTCTAGGG + Intergenic
1150138007 17:62706353-62706375 GCCACTGCCTCCGTTTTCTCTGG + Intronic
1152226758 17:79096360-79096382 CCCACTGCCCCCATTATATGAGG + Intronic
1163088207 19:14998424-14998446 GCCTCAGCCACCTGAATATCTGG - Intronic
1166817741 19:45557035-45557057 GTCACTGCCTCCTTCATGTCAGG + Intronic
1168374637 19:55866430-55866452 GCCAATTCCACATTTATTTCTGG + Intronic
926676687 2:15630041-15630063 TCCACTGGTACCTTTATATCCGG - Exonic
930107789 2:47653617-47653639 GCTACTGAGATCTTTATATCGGG + Intergenic
931568330 2:63640377-63640399 GCCACTGCCACCTGAATAGCTGG - Intronic
932300059 2:70660534-70660556 GCCACTGGAGCCTTTAAATCAGG - Exonic
934097024 2:88616178-88616200 GCAACTCCCAAATTTATATCTGG + Intronic
936713342 2:115159157-115159179 GCCACTTCCACCTTTTTACCTGG - Intronic
938032077 2:128003464-128003486 GCCACTGCAACCTTGACTTCTGG + Intronic
941911526 2:170769736-170769758 GCCACTGCCTCCTCTATTACAGG - Intergenic
945051367 2:205827347-205827369 GCCACTTCCACCCTTCTAACTGG + Intergenic
945097668 2:206234905-206234927 GCCTCTGCCTCCTGAATATCTGG + Intergenic
945421195 2:209639046-209639068 TTGACTACCACCTTTATATCAGG + Intronic
947105265 2:226662257-226662279 GCCTCTGCCATCTCTAAATCTGG + Intergenic
947808162 2:232982626-232982648 GCCTCTGCCACCTGCATAGCTGG + Intronic
948807586 2:240459668-240459690 GCCACTCAGCCCTTTATATCGGG + Intronic
1172458559 20:35096785-35096807 GCAACTGGCACTGTTATATCAGG + Intergenic
1176701362 21:10055280-10055302 GTCATTGTCACCTTTATACCAGG + Intergenic
1177813483 21:25950131-25950153 GCCACTGCCACATCTCTATATGG + Intronic
1177906247 21:26974320-26974342 CCCACTACCATCTTTACATCTGG - Intergenic
1178567061 21:33696904-33696926 ACTACTGTCACCTTTATCTCTGG - Intronic
1179559707 21:42207638-42207660 GGCACTGCCACCTTACTACCAGG + Intronic
1181411018 22:22719809-22719831 CCCACTACCACCTTTATCTTGGG + Intergenic
1182175246 22:28279483-28279505 GCCACAGCCTCCTTTGTAGCTGG + Intronic
1183396545 22:37574722-37574744 GCCACTGCCCCCTTGACTTCTGG - Intronic
949751523 3:7357603-7357625 TACACTGCCACCTTTCTAGCTGG + Intronic
950536842 3:13583736-13583758 GCTAATCCCACCTTTATATATGG - Intronic
950847449 3:16028730-16028752 GCCAGTGCCCCCTTTATAACAGG + Intergenic
952366312 3:32677924-32677946 GCCACTTCAACCTTTTCATCTGG - Intergenic
953463030 3:43096655-43096677 GCCTCTGCCTCCTCTATATTGGG + Intronic
964072788 3:152654938-152654960 GCCACTGCCAACTCCATCTCAGG - Intergenic
964728109 3:159836271-159836293 GCCATTGCCATCTATAAATCAGG - Intronic
964988625 3:162776640-162776662 GCAGCTGCCACCATCATATCTGG - Intergenic
965666803 3:171102918-171102940 TCTACTGCCACCTGTATGTCAGG + Intronic
966212441 3:177467653-177467675 GCTACTGCCACCTTAAGAGCTGG - Intergenic
967912088 3:194550830-194550852 GCCACGGCAACCTTCATTTCAGG - Intergenic
968348200 3:198029556-198029578 GCCTCAGCCACCTGAATATCTGG - Intronic
969312534 4:6362263-6362285 GCCACTCCCAGCCTTATGTCAGG - Intronic
970938929 4:21608281-21608303 CCCGCAGACACCTTTATATCAGG - Intronic
973223208 4:47752426-47752448 GCTACTGACAGCTTTATCTCAGG - Intronic
976527401 4:86110050-86110072 TCCTCTGCCCCCTTTATATGAGG + Intronic
977373504 4:96170524-96170546 GCGACTGCTGCCTTTACATCTGG - Intergenic
978651786 4:111014542-111014564 GCAACTGCCACCCTTAGAGCTGG + Intergenic
984350697 4:178588214-178588236 CTCACTGCCACCTTGATCTCTGG - Intergenic
990957911 5:61362311-61362333 GCCTCAGCCACCTTAATAGCTGG + Intronic
996903212 5:128567646-128567668 ACCACTGCCACCTTCAGATCAGG + Intronic
997018540 5:129967179-129967201 GCCCATGCCACATTTATATAGGG + Intronic
999282322 5:150373918-150373940 GCCACTGCCTCCTCTGTCTCTGG - Intronic
1003395032 6:5745852-5745874 TTTACAGCCACCTTTATATCAGG + Intronic
1007338904 6:41176883-41176905 TCCACTGCATCCTCTATATCTGG - Intergenic
1014913759 6:127120715-127120737 GGCACTGCCACCTTTTTAAAAGG - Intronic
1020305487 7:6830856-6830878 GCCTCTGCCTCCTATATAGCTGG + Intergenic
1020475171 7:8585838-8585860 GACAGTGCCACATTTTTATCGGG + Intronic
1020811992 7:12859154-12859176 GCCACTGGAACTTTTATATACGG - Intergenic
1024470947 7:49768486-49768508 TCCACTGCCACCTGTAAAGCTGG + Intergenic
1030958403 7:115884831-115884853 ACCACTGACACCTTTATAATTGG + Intergenic
1038466815 8:27772270-27772292 GCCACTGCTATGTTTGTATCGGG - Intronic
1039399513 8:37257368-37257390 GCCACTGGCAAGTTTTTATCTGG - Intergenic
1040711851 8:50198260-50198282 CCCACTGCCACCTTCAGAGCCGG - Intronic
1043240011 8:77921117-77921139 GCCGCTGACACCTTTCTCTCCGG + Intergenic
1046200044 8:110913882-110913904 GCCACTGCCAGCTGTATTACTGG + Intergenic
1051172078 9:14329015-14329037 GCAACTGCCCCCTTTAGATGGGG + Intronic
1051393546 9:16592943-16592965 TCCACTGCCATTTTTCTATCCGG + Intronic
1051409076 9:16770231-16770253 TCCACTGCCACCCTAAGATCAGG + Intronic
1052039858 9:23725687-23725709 GCCACTGTAAACTTTATATGGGG - Intronic
1053638505 9:40041823-40041845 GTCATTGTCACCTTTATACCAGG + Intergenic
1053767577 9:41423369-41423391 GTCATTGTCACCTTTATACCAGG - Intergenic
1054319301 9:63638366-63638388 GTCACTGTCACCTTTATACCAGG + Intergenic
1054546246 9:66334885-66334907 GTCATTGTCACCTTTATACCAGG - Intergenic
1054798123 9:69321508-69321530 GCCTCAGCCTCCTTTATAGCTGG - Intergenic
1054877597 9:70112864-70112886 CCCACTGCAACCTTTCTACCAGG - Intronic
1056785262 9:89588032-89588054 GCCTCAGCCTCCTCTATATCTGG + Intergenic
1059489182 9:114653107-114653129 GCCTCTGCCTCCTGTATTTCTGG + Intergenic
1060516955 9:124271902-124271924 GCCGCTGCCACCTGTCTCTCTGG - Intronic
1062619978 9:137416360-137416382 GCCTCTGCCACCTTCCCATCAGG + Intronic
1202786379 9_KI270719v1_random:25363-25385 GTCATTGTCACCTTTATACCAGG + Intergenic
1186233831 X:7485435-7485457 AGCACTGCCACCTTGATATTTGG - Intergenic
1187260069 X:17677377-17677399 GCGACTGCCACCTTAGTGTCTGG + Intronic
1190784757 X:53634859-53634881 GCCACTCCCCCCATTATCTCAGG - Intronic
1198269925 X:135047190-135047212 GCCACAGCCACCTCTTAATCTGG - Intergenic
1198466500 X:136909115-136909137 GCCCCTGCCATCTTCATTTCTGG - Intergenic
1200076413 X:153553500-153553522 GCCACTGCCACCTTCTCACCTGG - Intronic