ID: 1126849638

View in Genome Browser
Species Human (GRCh38)
Location 15:52789315-52789337
Sequence GATGCTGCCCAGACCGGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126849631_1126849638 17 Left 1126849631 15:52789275-52789297 CCGGGTGGGCATAGTGGGGGAGC 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 160
1126849629_1126849638 19 Left 1126849629 15:52789273-52789295 CCCCGGGTGGGCATAGTGGGGGA 0: 1
1: 0
2: 3
3: 8
4: 128
Right 1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 160
1126849635_1126849638 -5 Left 1126849635 15:52789297-52789319 CCCTTGCTGGGAGTTGTGGATGC 0: 1
1: 0
2: 0
3: 12
4: 171
Right 1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 160
1126849636_1126849638 -6 Left 1126849636 15:52789298-52789320 CCTTGCTGGGAGTTGTGGATGCT 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 160
1126849627_1126849638 20 Left 1126849627 15:52789272-52789294 CCCCCGGGTGGGCATAGTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 160
1126849630_1126849638 18 Left 1126849630 15:52789274-52789296 CCCGGGTGGGCATAGTGGGGGAG 0: 1
1: 0
2: 0
3: 34
4: 287
Right 1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126849638 Original CRISPR GATGCTGCCCAGACCGGAGC TGG Exonic
900246373 1:1638043-1638065 GGTGTTGCCCAGACCTCAGCTGG - Intronic
900300619 1:1974994-1975016 GATGCGGCTCAGGCCGGGGCTGG + Intronic
900971179 1:5993110-5993132 GAGGCTGCTAGGACCGGAGCGGG - Intronic
901060879 1:6471398-6471420 GATGCTGGGCAGACCGGATCGGG + Intronic
901436687 1:9250947-9250969 GCTGCTGCACAGGCCGGAGGGGG + Intronic
901733159 1:11295017-11295039 GATGCTGCCCACCCCGAGGCAGG - Intronic
905435830 1:37954558-37954580 GCTGCTGCCCAGACTGTAGTTGG + Intergenic
906025248 1:42667977-42667999 CATGCTGCCCAGCGCAGAGCAGG - Intronic
906351056 1:45059937-45059959 GAGGCTGACCAGACCTGAGCAGG - Intronic
910086620 1:83410848-83410870 GATGGGGCCCTGACAGGAGCAGG + Intergenic
911062787 1:93762335-93762357 GATGGTGCACAGAGCAGAGCTGG - Intronic
912518722 1:110231283-110231305 GACGCTGGCCAGAGCAGAGCAGG - Intronic
915244076 1:154543992-154544014 AATGCTTCCGAGACCTGAGCTGG + Exonic
916094799 1:161339708-161339730 CTTGTTGCCCAGACTGGAGCTGG + Intronic
917678348 1:177341098-177341120 GGTGATGCCCACACCAGAGCTGG - Intergenic
920219884 1:204389226-204389248 GCTGTTGCCCAGGCTGGAGCTGG + Intergenic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
921349375 1:214219969-214219991 GTTGCAGCCCAGAATGGAGCAGG + Intergenic
922966198 1:229692998-229693020 GATGCTGCCTAGATCTAAGCTGG - Intergenic
1062806397 10:422954-422976 GATGCTGCCCTGGCTGGAGGTGG + Exonic
1066067781 10:31774801-31774823 AGTGCTGCCCAGCCTGGAGCAGG + Intergenic
1074392729 10:113071584-113071606 GCTGCTGCCCAGAACGGAAAAGG - Intronic
1075573120 10:123559399-123559421 GATTGTGCCCAGCCCCGAGCGGG - Intergenic
1075941384 10:126393098-126393120 TCTGTTGCCCAGACTGGAGCTGG - Intergenic
1075957009 10:126532805-126532827 TCTGTTGCCCAGACTGGAGCTGG - Intronic
1076156114 10:128206997-128207019 GCTGCTGGCCAGGCCTGAGCAGG + Intergenic
1078534149 11:12160032-12160054 GAAGCTGGCCAGGCCTGAGCAGG + Intronic
1079185526 11:18232422-18232444 GATGCTGCCCAAAGAGGACCTGG - Exonic
1079355043 11:19723674-19723696 GATCCTGCCCAGATTGCAGCAGG - Intronic
1084982595 11:72838861-72838883 GGAGCTGCCCGGACCTGAGCAGG + Exonic
1087282100 11:96222449-96222471 GATGCTGCCCATATCAGAGAAGG + Intronic
1089017888 11:115181878-115181900 GATGCTGCCCAGGGGGGAACTGG + Intronic
1090394092 11:126407648-126407670 GAAGGTGCCCAGACTGGAGTCGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1093965681 12:25322561-25322583 GATGCTGCCGAGATCAGAGAGGG + Intergenic
1094629012 12:32153921-32153943 GATGGTGACCAGACCAGAGTTGG - Intronic
1096077533 12:48814742-48814764 GGCGCTGCCCAGGCCAGAGCAGG - Intronic
1096378333 12:51133505-51133527 GATGCTGCCCAGACTGAGACTGG + Intronic
1103597042 12:122030339-122030361 TCTGCTGCCCAGACAGGCGCGGG + Intronic
1103976029 12:124703324-124703346 GATGCTGCCCACATAGGAGCAGG + Intergenic
1113769170 13:112897653-112897675 GATGCTGTGGAGACCGGAGAGGG + Intronic
1118322932 14:64763948-64763970 GCAGCTGTCCAGACAGGAGCAGG + Intronic
1121243680 14:92447707-92447729 GAAGCTGCCCAGAGCAGGGCGGG - Intronic
1123935250 15:25190952-25190974 GATGCAGCCCAGATTCGAGCAGG + Intergenic
1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG + Exonic
1128740187 15:70078594-70078616 GATGCTGCCCATGCTGGGGCAGG - Intronic
1128792752 15:70445100-70445122 GATGCTGGCCATCCTGGAGCTGG - Intergenic
1128944694 15:71812402-71812424 GATGCTGTCCAGGCCGCAGGGGG - Exonic
1128976979 15:72161316-72161338 GATGCTGCCCACGGCGGAGATGG - Exonic
1129738997 15:77980826-77980848 GAGGCTGCTCATACCGCAGCAGG + Intergenic
1129846957 15:78772349-78772371 GAGGCTGCTCATACCGCAGCAGG - Intronic
1130380917 15:83371843-83371865 AATGCTGCCCAGGCCAGAGAAGG + Intergenic
1131260283 15:90884340-90884362 GCTGCGGCCCAGCGCGGAGCAGG + Intronic
1131588400 15:93720943-93720965 GCTGCTGCCCGGAGCTGAGCTGG - Intergenic
1132404802 15:101535814-101535836 GATGAGGACCAGACCGGTGCTGG + Intergenic
1132517438 16:372368-372390 TCTGCTGCCCAGACCTGGGCAGG - Intronic
1132727163 16:1343893-1343915 GGTGCTGCTCAGAGCAGAGCTGG + Intronic
1136498799 16:30659543-30659565 TCTGCTGCCCAGCCCGGACCCGG - Exonic
1142284245 16:89165297-89165319 GGTGGTGCCCAGACTGGAGGAGG - Intergenic
1142298544 16:89242921-89242943 GTTGCTGACCAGCCCAGAGCTGG - Intergenic
1142312275 16:89320996-89321018 GATGCTGTCAAGACCGGCCCAGG + Intronic
1146821343 17:35985595-35985617 GATGCTGCCTGGAATGGAGCTGG - Intronic
1148852831 17:50562965-50562987 GAAGCTGTCCAGACCTGAGATGG - Intronic
1149151401 17:53568530-53568552 TCTGTTGTCCAGACCGGAGCTGG - Intergenic
1150340534 17:64363053-64363075 GAGTCTGCTCAGACCGGAGAGGG + Intronic
1151569656 17:74919891-74919913 CATGGTGCCCAGGCCGGGGCGGG + Exonic
1151921008 17:77155492-77155514 GCTGGTGCCCAGATGGGAGCTGG + Intronic
1152552150 17:81035218-81035240 GCTGCACCACAGACCGGAGCGGG - Exonic
1155449973 18:25953244-25953266 GATGCCGCCAACACCAGAGCAGG - Intergenic
1157094923 18:44679380-44679402 GCCGCTTCCCAGACCAGAGCCGG - Intergenic
1157662836 18:49460555-49460577 GCTGCAGGCCGGACCGGAGCCGG - Exonic
1159088271 18:63818743-63818765 GATTCTGCCCAGGTTGGAGCTGG + Intergenic
1160748918 19:724650-724672 GCTGCTGCCCAGGCTGGAGTAGG + Intronic
1161327116 19:3669289-3669311 ACTGCTGCCCAGCCCAGAGCAGG - Intronic
1163478272 19:17539584-17539606 GAAGCTGCCCAGACCGGTCGAGG - Exonic
1163778629 19:19233293-19233315 GATGCTGCCCTGACAGGATCTGG + Intronic
1164443909 19:28300928-28300950 GATGCTGCTCAGGCAGGAGCAGG - Intergenic
1164623499 19:29711875-29711897 GATGCTGGCCTGGCTGGAGCAGG - Intronic
1165093423 19:33397985-33398007 GGTCCTGCCCAGGCCGCAGCAGG + Intronic
925971277 2:9108205-9108227 GATGGTGCTGTGACCGGAGCAGG + Intergenic
927156672 2:20224865-20224887 CATGCTGCCCGGACCGGCGGCGG + Exonic
927195136 2:20541678-20541700 GATGCTGCACATATAGGAGCTGG - Intergenic
927236539 2:20880344-20880366 GATGCTGTCCAGACCTGGCCAGG - Intergenic
927904881 2:26848866-26848888 GCGGCTGCCCAGCCCGGAGCGGG + Intronic
927936530 2:27079464-27079486 GAAGCTGCCCTGAGGGGAGCGGG + Intronic
928152572 2:28845289-28845311 TATGTTGCCCAGACTGGTGCTGG + Intronic
928299838 2:30115393-30115415 GATACTGACAAGACCGGAGGAGG - Intergenic
928333824 2:30378307-30378329 GAGGGTGGCCAGACCAGAGCTGG - Intergenic
934149015 2:89127403-89127425 GATGCTGACCAGAGCAGTGCAGG - Intergenic
934218279 2:90054643-90054665 GATGCTGACCAGAGCAGTGCAGG + Intergenic
940330316 2:152466988-152467010 GAAGCTTCCCAGACTGGAGGAGG - Intronic
942267413 2:174242370-174242392 GCTGCTGACCTGACCGGAGGTGG + Intronic
947739840 2:232480048-232480070 GGTGGTGCCCAGAGCGGGGCTGG + Exonic
948778852 2:240304740-240304762 GATGCTGCCCAGAGCCATGCTGG + Intergenic
948871401 2:240800457-240800479 GGGGCTGCCAAGACGGGAGCTGG + Intronic
1169122885 20:3107835-3107857 GGTACTGCCCAGACCGCTGCAGG - Exonic
1171200946 20:23241789-23241811 GATGCTGCCCTCAGCAGAGCTGG + Intergenic
1174366177 20:50057781-50057803 TATGCTGCCCAGTCCAGAGTGGG - Intergenic
1174377120 20:50133502-50133524 AAGACTGCCCAGACCAGAGCAGG - Intronic
1175482822 20:59323449-59323471 AATGGTGCCCAGCCCGTAGCAGG - Intronic
1181585303 22:23849718-23849740 GACGCCGCCCAGACCGGCTCCGG - Intergenic
1181935317 22:26434028-26434050 GATGCGGCCCATGCCGGACCAGG - Exonic
1182122322 22:27796225-27796247 GATGCTGCCGACACCAGGGCTGG + Intronic
1183701706 22:39454732-39454754 GAAGCTGCCCTGCCCAGAGCTGG - Intergenic
1184240007 22:43207025-43207047 GCTGCTGCCCAGGGCTGAGCTGG + Intronic
1184427592 22:44422160-44422182 AATTCTGCCCGGACAGGAGCTGG + Intergenic
1184692270 22:46122782-46122804 GATGGTGGCCAGGCCGGTGCTGG - Intergenic
1185111023 22:48900278-48900300 GCTGCTGCCCACACCGGGGAGGG + Intergenic
953947861 3:47164340-47164362 GATGTGGGCCAGACCGGACCTGG + Intergenic
954452903 3:50581237-50581259 GAGTCTGCACAGACCAGAGCTGG - Exonic
957738665 3:84234071-84234093 GAAGCTGCCAAGACAGCAGCGGG + Intergenic
961353613 3:126320005-126320027 GAAGCTGGCCAGGCTGGAGCAGG + Intergenic
962478775 3:135780527-135780549 GAAGCTGCCCAGATAGTAGCTGG + Intergenic
963046244 3:141104652-141104674 TTTGCTGCCCAGACCTGGGCAGG + Intronic
966839259 3:184075515-184075537 CATGTTGGCCAGGCCGGAGCTGG + Intergenic
968262931 3:197339768-197339790 GCTGCTGCCCAGGCAGGAGACGG - Intergenic
968681799 4:1926101-1926123 AATGCTGCTCATACTGGAGCCGG - Intronic
969604265 4:8194566-8194588 GCAGCTTCCCAGCCCGGAGCAGG + Intronic
977767689 4:100819635-100819657 GATGCAGCACAGAACGGGGCGGG + Intronic
978432615 4:108649751-108649773 AATGTTGCCCAGACCAGAGATGG + Intergenic
982027442 4:151264837-151264859 GATGCTGACCAGAGCTGAGTTGG + Intronic
985145309 4:186889645-186889667 GACGATGCCCACACTGGAGCTGG - Intergenic
985159417 4:187028717-187028739 GCTGCTGCCCAGACCAGTGTGGG - Intergenic
985595049 5:784296-784318 GACCCTGCCCAGCCCGGGGCTGG - Intergenic
989414247 5:41154997-41155019 GATGCTTACCAGACGGGACCTGG - Exonic
994140227 5:96333537-96333559 GAGGCTGCCCAGATCAGAACAGG - Intergenic
994425939 5:99587243-99587265 GCTGCTGCCTAGAGCTGAGCTGG + Intergenic
998094150 5:139387947-139387969 GATGCTGCCCAGCCCACAGTGGG + Intronic
1001425856 5:171621961-171621983 GTTGCTGCCCTGCCCAGAGCTGG + Intergenic
1002175192 5:177397677-177397699 CCTGCTGCCCAGACCAGATCGGG + Intronic
1002308395 5:178297741-178297763 CTTGCTGCCCAGATTGGAGCTGG + Intronic
1002439795 5:179258352-179258374 GGTGCTGCCCAAACCACAGCAGG - Intronic
1003406559 6:5831360-5831382 CATGCTGCCCAGTCCTGGGCTGG + Intergenic
1003435376 6:6083170-6083192 CATGCTTCCCAGATGGGAGCTGG - Intergenic
1005256208 6:24005869-24005891 CCTGCTTCCCAGACCTGAGCAGG + Intergenic
1007520796 6:42450984-42451006 GATGCTGTGCAGCCCGGAGAGGG + Intronic
1012444942 6:99297666-99297688 GATGCTCTCCAGACCTGGGCAGG + Intronic
1012840295 6:104321119-104321141 GATCCGGCCCAGACAGCAGCAGG + Intergenic
1017984775 6:159434422-159434444 GTAGCTGCCAAGACTGGAGCTGG + Intergenic
1019774953 7:2906817-2906839 GCTGCTGCCCCGACCTGAGACGG - Exonic
1024308867 7:47950823-47950845 GAGGCTGCCCAGCCCAGCGCTGG - Intronic
1025254514 7:57374545-57374567 GTTGATGCCCAGACAGCAGCAGG + Intergenic
1026036262 7:66832615-66832637 GCTTCTGCCCAGACCGGAACTGG + Intergenic
1027214336 7:76174128-76174150 GCTCCTGCCCAGACCAGAACTGG - Intergenic
1027303497 7:76867330-76867352 GATGGGGCCCTGACAGGAGCAGG + Intergenic
1029005584 7:97205959-97205981 GTTGCTGCCTACACCGGAGCTGG - Intergenic
1029438503 7:100575173-100575195 GAAGCCGCCCAGACCAGAGGGGG + Exonic
1029604065 7:101588030-101588052 ATTGCTGCCCAGCCCAGAGCAGG - Intergenic
1029982816 7:104895211-104895233 AATGGTTCCCAGACCAGAGCTGG + Intronic
1032475835 7:132211035-132211057 CACGCTGCCCAGACTGGGGCTGG + Exonic
1034270838 7:149802838-149802860 GCTGCTGCCCAGGCCGGGGGAGG + Intergenic
1035110584 7:156478545-156478567 GGTGCTGCCCAGCCCGAGGCAGG + Intergenic
1037262821 8:17027253-17027275 GAGGCCGCCCACACCAGAGCTGG - Exonic
1038152983 8:24958898-24958920 GAGGCTGCCCAGAAAGGAGAGGG + Intergenic
1040725429 8:50377003-50377025 CATGATGCCCAGGCAGGAGCCGG - Intronic
1041390423 8:57342815-57342837 GAGGCTGCCAAGAGCAGAGCAGG - Intergenic
1045504689 8:102770092-102770114 GGTGCTGCCCAGGAAGGAGCGGG + Intergenic
1049566170 8:143340290-143340312 AATGCTGTGCAGACCGGTGCTGG - Intronic
1049762216 8:144336724-144336746 GGTGCTGCCCAGGCCGGCGCTGG - Intergenic
1052045184 9:23785752-23785774 TATTCTGCTCAGACTGGAGCTGG - Intronic
1053288436 9:36864671-36864693 CATGCTGGCCAGGCCGGAGGAGG - Intronic
1056464384 9:86839355-86839377 GATGCTGCCCTGTCGGGAGTGGG + Intergenic
1056913969 9:90729423-90729445 GGGCCTGCCCAGGCCGGAGCCGG + Intergenic
1060114478 9:120929229-120929251 GCTGCTCCCCAGACCGCCGCGGG + Intergenic
1061036059 9:128114969-128114991 GCTGCTGCCCACATCGGACCCGG + Intergenic
1061422038 9:130477821-130477843 GTGGCTGCCCACACTGGAGCTGG + Intronic
1061890458 9:133616584-133616606 GATGCTCCACAGGCCAGAGCTGG + Intergenic
1062341381 9:136095203-136095225 GCAGCTGCCCAGGCCGGACCGGG - Exonic
1062392286 9:136338608-136338630 GGTGTTGCCCAGACTGTAGCAGG - Exonic
1189796566 X:44651447-44651469 GGGGCTGCCCAGAGGGGAGCTGG + Intergenic