ID: 1126850425

View in Genome Browser
Species Human (GRCh38)
Location 15:52793564-52793586
Sequence TTTTCTTTGCTGAACCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126850425_1126850427 14 Left 1126850425 15:52793564-52793586 CCTACCAGGTTCAGCAAAGAAAA No data
Right 1126850427 15:52793601-52793623 AAAACCATTCCTCCAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126850425 Original CRISPR TTTTCTTTGCTGAACCTGGT AGG (reversed) Intergenic
No off target data available for this crispr