ID: 1126851109

View in Genome Browser
Species Human (GRCh38)
Location 15:52797860-52797882
Sequence ATGATGTTAATGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126851106_1126851109 9 Left 1126851106 15:52797828-52797850 CCCAACGACAGGGTTATTGATAG No data
Right 1126851109 15:52797860-52797882 ATGATGTTAATGATGGAAAAAGG No data
1126851103_1126851109 24 Left 1126851103 15:52797813-52797835 CCGTGAAACTCGGCTCCCAACGA No data
Right 1126851109 15:52797860-52797882 ATGATGTTAATGATGGAAAAAGG No data
1126851107_1126851109 8 Left 1126851107 15:52797829-52797851 CCAACGACAGGGTTATTGATAGC No data
Right 1126851109 15:52797860-52797882 ATGATGTTAATGATGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126851109 Original CRISPR ATGATGTTAATGATGGAAAA AGG Intergenic
No off target data available for this crispr