ID: 1126852695

View in Genome Browser
Species Human (GRCh38)
Location 15:52806568-52806590
Sequence ATCTGGCCTTCTCTAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126852695_1126852701 -10 Left 1126852695 15:52806568-52806590 CCTCCCTCTAGAGAAGGCCAGAT No data
Right 1126852701 15:52806581-52806603 AAGGCCAGATTGTCCAAAGGGGG No data
1126852695_1126852705 4 Left 1126852695 15:52806568-52806590 CCTCCCTCTAGAGAAGGCCAGAT No data
Right 1126852705 15:52806595-52806617 CAAAGGGGGAAAGTAAGAGAGGG No data
1126852695_1126852704 3 Left 1126852695 15:52806568-52806590 CCTCCCTCTAGAGAAGGCCAGAT No data
Right 1126852704 15:52806594-52806616 CCAAAGGGGGAAAGTAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126852695 Original CRISPR ATCTGGCCTTCTCTAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr