ID: 1126852701

View in Genome Browser
Species Human (GRCh38)
Location 15:52806581-52806603
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126852695_1126852701 -10 Left 1126852695 15:52806568-52806590 CCTCCCTCTAGAGAAGGCCAGAT No data
Right 1126852701 15:52806581-52806603 AAGGCCAGATTGTCCAAAGGGGG No data
1126852693_1126852701 -5 Left 1126852693 15:52806563-52806585 CCAGCCCTCCCTCTAGAGAAGGC No data
Right 1126852701 15:52806581-52806603 AAGGCCAGATTGTCCAAAGGGGG No data
1126852688_1126852701 20 Left 1126852688 15:52806538-52806560 CCAGAGAACCTTTAACCCTTTCA No data
Right 1126852701 15:52806581-52806603 AAGGCCAGATTGTCCAAAGGGGG No data
1126852690_1126852701 5 Left 1126852690 15:52806553-52806575 CCCTTTCACGCCAGCCCTCCCTC No data
Right 1126852701 15:52806581-52806603 AAGGCCAGATTGTCCAAAGGGGG No data
1126852691_1126852701 4 Left 1126852691 15:52806554-52806576 CCTTTCACGCCAGCCCTCCCTCT No data
Right 1126852701 15:52806581-52806603 AAGGCCAGATTGTCCAAAGGGGG No data
1126852689_1126852701 12 Left 1126852689 15:52806546-52806568 CCTTTAACCCTTTCACGCCAGCC No data
Right 1126852701 15:52806581-52806603 AAGGCCAGATTGTCCAAAGGGGG No data
1126852694_1126852701 -9 Left 1126852694 15:52806567-52806589 CCCTCCCTCTAGAGAAGGCCAGA No data
Right 1126852701 15:52806581-52806603 AAGGCCAGATTGTCCAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126852701 Original CRISPR AAGGCCAGATTGTCCAAAGG GGG Intergenic
No off target data available for this crispr