ID: 1126852704

View in Genome Browser
Species Human (GRCh38)
Location 15:52806594-52806616
Sequence CCAAAGGGGGAAAGTAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126852697_1126852704 -1 Left 1126852697 15:52806572-52806594 CCTCTAGAGAAGGCCAGATTGTC No data
Right 1126852704 15:52806594-52806616 CCAAAGGGGGAAAGTAAGAGAGG No data
1126852693_1126852704 8 Left 1126852693 15:52806563-52806585 CCAGCCCTCCCTCTAGAGAAGGC No data
Right 1126852704 15:52806594-52806616 CCAAAGGGGGAAAGTAAGAGAGG No data
1126852696_1126852704 0 Left 1126852696 15:52806571-52806593 CCCTCTAGAGAAGGCCAGATTGT No data
Right 1126852704 15:52806594-52806616 CCAAAGGGGGAAAGTAAGAGAGG No data
1126852690_1126852704 18 Left 1126852690 15:52806553-52806575 CCCTTTCACGCCAGCCCTCCCTC No data
Right 1126852704 15:52806594-52806616 CCAAAGGGGGAAAGTAAGAGAGG No data
1126852694_1126852704 4 Left 1126852694 15:52806567-52806589 CCCTCCCTCTAGAGAAGGCCAGA No data
Right 1126852704 15:52806594-52806616 CCAAAGGGGGAAAGTAAGAGAGG No data
1126852691_1126852704 17 Left 1126852691 15:52806554-52806576 CCTTTCACGCCAGCCCTCCCTCT No data
Right 1126852704 15:52806594-52806616 CCAAAGGGGGAAAGTAAGAGAGG No data
1126852695_1126852704 3 Left 1126852695 15:52806568-52806590 CCTCCCTCTAGAGAAGGCCAGAT No data
Right 1126852704 15:52806594-52806616 CCAAAGGGGGAAAGTAAGAGAGG No data
1126852689_1126852704 25 Left 1126852689 15:52806546-52806568 CCTTTAACCCTTTCACGCCAGCC No data
Right 1126852704 15:52806594-52806616 CCAAAGGGGGAAAGTAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126852704 Original CRISPR CCAAAGGGGGAAAGTAAGAG AGG Intergenic
No off target data available for this crispr