ID: 1126855685

View in Genome Browser
Species Human (GRCh38)
Location 15:52837250-52837272
Sequence AGTAGGACATTAATCTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126855684_1126855685 -7 Left 1126855684 15:52837234-52837256 CCTGTCTGACTGCTTGAGTAGGA No data
Right 1126855685 15:52837250-52837272 AGTAGGACATTAATCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126855685 Original CRISPR AGTAGGACATTAATCTTTCC TGG Intergenic
No off target data available for this crispr