ID: 1126856203

View in Genome Browser
Species Human (GRCh38)
Location 15:52841784-52841806
Sequence CAGTGAATCTGGAGAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126856200_1126856203 -5 Left 1126856200 15:52841766-52841788 CCATATGTGTGATGGAGCCAGTG No data
Right 1126856203 15:52841784-52841806 CAGTGAATCTGGAGAGCAGCAGG No data
1126856199_1126856203 -4 Left 1126856199 15:52841765-52841787 CCCATATGTGTGATGGAGCCAGT No data
Right 1126856203 15:52841784-52841806 CAGTGAATCTGGAGAGCAGCAGG No data
1126856196_1126856203 23 Left 1126856196 15:52841738-52841760 CCAAGTGTGTAATGGTGGGAAGA No data
Right 1126856203 15:52841784-52841806 CAGTGAATCTGGAGAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126856203 Original CRISPR CAGTGAATCTGGAGAGCAGC AGG Intergenic
No off target data available for this crispr