ID: 1126857023

View in Genome Browser
Species Human (GRCh38)
Location 15:52848469-52848491
Sequence CAGGAAAACCACTATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126857023_1126857030 17 Left 1126857023 15:52848469-52848491 CCTTCCTCATAGTGGTTTTCCTG No data
Right 1126857030 15:52848509-52848531 TTGTTCTCCTTCTTTGCAGAGGG No data
1126857023_1126857029 16 Left 1126857023 15:52848469-52848491 CCTTCCTCATAGTGGTTTTCCTG No data
Right 1126857029 15:52848508-52848530 CTTGTTCTCCTTCTTTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126857023 Original CRISPR CAGGAAAACCACTATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr