ID: 1126857030

View in Genome Browser
Species Human (GRCh38)
Location 15:52848509-52848531
Sequence TTGTTCTCCTTCTTTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126857023_1126857030 17 Left 1126857023 15:52848469-52848491 CCTTCCTCATAGTGGTTTTCCTG No data
Right 1126857030 15:52848509-52848531 TTGTTCTCCTTCTTTGCAGAGGG No data
1126857028_1126857030 -2 Left 1126857028 15:52848488-52848510 CCTGCTCACACTGGGGCTTTCTT No data
Right 1126857030 15:52848509-52848531 TTGTTCTCCTTCTTTGCAGAGGG No data
1126857024_1126857030 13 Left 1126857024 15:52848473-52848495 CCTCATAGTGGTTTTCCTGCTCA No data
Right 1126857030 15:52848509-52848531 TTGTTCTCCTTCTTTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126857030 Original CRISPR TTGTTCTCCTTCTTTGCAGA GGG Intergenic
No off target data available for this crispr