ID: 1126857640

View in Genome Browser
Species Human (GRCh38)
Location 15:52854530-52854552
Sequence ACTATCTACGAGAGTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126857640_1126857650 27 Left 1126857640 15:52854530-52854552 CCTCCCCCACTCTCGTAGATAGT No data
Right 1126857650 15:52854580-52854602 TATTCTTTATCACCTTTCTGTGG No data
1126857640_1126857647 -2 Left 1126857640 15:52854530-52854552 CCTCCCCCACTCTCGTAGATAGT No data
Right 1126857647 15:52854551-52854573 GTTCTAGAAGGGTGTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126857640 Original CRISPR ACTATCTACGAGAGTGGGGG AGG (reversed) Intergenic
No off target data available for this crispr