ID: 1126865676

View in Genome Browser
Species Human (GRCh38)
Location 15:52934248-52934270
Sequence GCTACTGTGTCCAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126865671_1126865676 10 Left 1126865671 15:52934215-52934237 CCAATTTTTCGATGAGAATAATA No data
Right 1126865676 15:52934248-52934270 GCTACTGTGTCCAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126865676 Original CRISPR GCTACTGTGTCCAAGGAGGA TGG Intergenic
No off target data available for this crispr