ID: 1126866905

View in Genome Browser
Species Human (GRCh38)
Location 15:52946719-52946741
Sequence GAGGGCCCACACTTAGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126866898_1126866905 16 Left 1126866898 15:52946680-52946702 CCTAGTGTACATAAACAAGACTT No data
Right 1126866905 15:52946719-52946741 GAGGGCCCACACTTAGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126866905 Original CRISPR GAGGGCCCACACTTAGGCCT TGG Intergenic
No off target data available for this crispr