ID: 1126866907

View in Genome Browser
Species Human (GRCh38)
Location 15:52946725-52946747
Sequence ATAAAGCCAAGGCCTAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126866907_1126866909 9 Left 1126866907 15:52946725-52946747 CCACACTTAGGCCTTGGCTTTAT No data
Right 1126866909 15:52946757-52946779 AAGATTAACAAATGAATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126866907 Original CRISPR ATAAAGCCAAGGCCTAAGTG TGG (reversed) Intergenic
No off target data available for this crispr