ID: 1126866954

View in Genome Browser
Species Human (GRCh38)
Location 15:52947279-52947301
Sequence AATTAAGCACACAAATAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126866954_1126866957 24 Left 1126866954 15:52947279-52947301 CCAAGCTATTTGTGTGCTTAATT No data
Right 1126866957 15:52947326-52947348 GTAAGAAGTGTGACTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126866954 Original CRISPR AATTAAGCACACAAATAGCT TGG (reversed) Intergenic
No off target data available for this crispr