ID: 1126872295

View in Genome Browser
Species Human (GRCh38)
Location 15:53002567-53002589
Sequence CATTCTAGACAGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126872295_1126872301 13 Left 1126872295 15:53002567-53002589 CCCAGCTCCCTCTGTCTAGAATG No data
Right 1126872301 15:53002603-53002625 TTTAATCCCCACTCTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126872295 Original CRISPR CATTCTAGACAGAGGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr