ID: 1126877533

View in Genome Browser
Species Human (GRCh38)
Location 15:53060419-53060441
Sequence CAGTTCTGACCACTTGGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126877527_1126877533 8 Left 1126877527 15:53060388-53060410 CCCTCAATATTTGGCCTCCTGGT No data
Right 1126877533 15:53060419-53060441 CAGTTCTGACCACTTGGCCTCGG No data
1126877528_1126877533 7 Left 1126877528 15:53060389-53060411 CCTCAATATTTGGCCTCCTGGTT No data
Right 1126877533 15:53060419-53060441 CAGTTCTGACCACTTGGCCTCGG No data
1126877530_1126877533 -9 Left 1126877530 15:53060405-53060427 CCTGGTTGCTGCCACAGTTCTGA No data
Right 1126877533 15:53060419-53060441 CAGTTCTGACCACTTGGCCTCGG No data
1126877529_1126877533 -6 Left 1126877529 15:53060402-53060424 CCTCCTGGTTGCTGCCACAGTTC No data
Right 1126877533 15:53060419-53060441 CAGTTCTGACCACTTGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126877533 Original CRISPR CAGTTCTGACCACTTGGCCT CGG Intergenic
No off target data available for this crispr