ID: 1126879443

View in Genome Browser
Species Human (GRCh38)
Location 15:53078682-53078704
Sequence CAAGGAGCCCACATTCTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126879437_1126879443 24 Left 1126879437 15:53078635-53078657 CCAGGGATGAGGCATTGAAGAGG No data
Right 1126879443 15:53078682-53078704 CAAGGAGCCCACATTCTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126879443 Original CRISPR CAAGGAGCCCACATTCTTAT GGG Intergenic
No off target data available for this crispr