ID: 1126879513

View in Genome Browser
Species Human (GRCh38)
Location 15:53079371-53079393
Sequence TGTGATTGATAAACGCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126879510_1126879513 24 Left 1126879510 15:53079324-53079346 CCAAAGATACAGAGCTAAGCAGA No data
Right 1126879513 15:53079371-53079393 TGTGATTGATAAACGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126879513 Original CRISPR TGTGATTGATAAACGCCTGC TGG Intergenic
No off target data available for this crispr