ID: 1126882209

View in Genome Browser
Species Human (GRCh38)
Location 15:53111243-53111265
Sequence CTGAGTGTATGTGAGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126882209_1126882216 26 Left 1126882209 15:53111243-53111265 CCCACTGCCTCACATACACTCAG No data
Right 1126882216 15:53111292-53111314 ATTGGCCAGATAGAGATGTGAGG No data
1126882209_1126882212 8 Left 1126882209 15:53111243-53111265 CCCACTGCCTCACATACACTCAG No data
Right 1126882212 15:53111274-53111296 ATATTTGACCCCAAGAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126882209 Original CRISPR CTGAGTGTATGTGAGGCAGT GGG (reversed) Intergenic
No off target data available for this crispr