ID: 1126883092

View in Genome Browser
Species Human (GRCh38)
Location 15:53120195-53120217
Sequence CTGTGCCACTAGAAGTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126883092_1126883093 -5 Left 1126883092 15:53120195-53120217 CCTACACACTTCTAGTGGCACAG No data
Right 1126883093 15:53120213-53120235 CACAGTCTGTTGAATACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126883092 Original CRISPR CTGTGCCACTAGAAGTGTGT AGG (reversed) Intergenic
No off target data available for this crispr