ID: 1126892284

View in Genome Browser
Species Human (GRCh38)
Location 15:53219241-53219263
Sequence CCCCAACCTCTGGCATGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126892284_1126892293 -9 Left 1126892284 15:53219241-53219263 CCTAGGCATGCCAGAGGTTGGGG No data
Right 1126892293 15:53219255-53219277 AGGTTGGGGTGGGGGTGGGAAGG No data
1126892284_1126892295 -4 Left 1126892284 15:53219241-53219263 CCTAGGCATGCCAGAGGTTGGGG No data
Right 1126892295 15:53219260-53219282 GGGGTGGGGGTGGGAAGGGAAGG No data
1126892284_1126892296 23 Left 1126892284 15:53219241-53219263 CCTAGGCATGCCAGAGGTTGGGG No data
Right 1126892296 15:53219287-53219309 AGATGAACTAGACAGTCTCCAGG No data
1126892284_1126892294 -8 Left 1126892284 15:53219241-53219263 CCTAGGCATGCCAGAGGTTGGGG No data
Right 1126892294 15:53219256-53219278 GGTTGGGGTGGGGGTGGGAAGGG No data
1126892284_1126892297 30 Left 1126892284 15:53219241-53219263 CCTAGGCATGCCAGAGGTTGGGG No data
Right 1126892297 15:53219294-53219316 CTAGACAGTCTCCAGGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126892284 Original CRISPR CCCCAACCTCTGGCATGCCT AGG (reversed) Intergenic
No off target data available for this crispr