ID: 1126892618

View in Genome Browser
Species Human (GRCh38)
Location 15:53222664-53222686
Sequence CTAGATAAGCACATTTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126892616_1126892618 4 Left 1126892616 15:53222637-53222659 CCCTGGTGCAGGCTTAGCAACTC No data
Right 1126892618 15:53222664-53222686 CTAGATAAGCACATTTATCTAGG No data
1126892615_1126892618 13 Left 1126892615 15:53222628-53222650 CCTGCTACTCCCTGGTGCAGGCT No data
Right 1126892618 15:53222664-53222686 CTAGATAAGCACATTTATCTAGG No data
1126892617_1126892618 3 Left 1126892617 15:53222638-53222660 CCTGGTGCAGGCTTAGCAACTCA No data
Right 1126892618 15:53222664-53222686 CTAGATAAGCACATTTATCTAGG No data
1126892612_1126892618 21 Left 1126892612 15:53222620-53222642 CCGTTCTTCCTGCTACTCCCTGG No data
Right 1126892618 15:53222664-53222686 CTAGATAAGCACATTTATCTAGG No data
1126892611_1126892618 30 Left 1126892611 15:53222611-53222633 CCGCTATTGCCGTTCTTCCTGCT No data
Right 1126892618 15:53222664-53222686 CTAGATAAGCACATTTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126892618 Original CRISPR CTAGATAAGCACATTTATCT AGG Intergenic
No off target data available for this crispr