ID: 1126899011

View in Genome Browser
Species Human (GRCh38)
Location 15:53292203-53292225
Sequence CTCCATGTTGCTTCGGAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126899011_1126899018 13 Left 1126899011 15:53292203-53292225 CCCGGTTCCGAAGCAACATGGAG No data
Right 1126899018 15:53292239-53292261 CAGGGCCAAAACTTCATTGCAGG No data
1126899011_1126899017 -5 Left 1126899011 15:53292203-53292225 CCCGGTTCCGAAGCAACATGGAG No data
Right 1126899017 15:53292221-53292243 TGGAGGTGTTTCTAGGCACAGGG No data
1126899011_1126899016 -6 Left 1126899011 15:53292203-53292225 CCCGGTTCCGAAGCAACATGGAG No data
Right 1126899016 15:53292220-53292242 ATGGAGGTGTTTCTAGGCACAGG No data
1126899011_1126899019 14 Left 1126899011 15:53292203-53292225 CCCGGTTCCGAAGCAACATGGAG No data
Right 1126899019 15:53292240-53292262 AGGGCCAAAACTTCATTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126899011 Original CRISPR CTCCATGTTGCTTCGGAACC GGG (reversed) Intergenic
No off target data available for this crispr