ID: 1126908127

View in Genome Browser
Species Human (GRCh38)
Location 15:53389397-53389419
Sequence CAGGCTGAGGAGAGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126908123_1126908127 -9 Left 1126908123 15:53389383-53389405 CCTAGCACCTACTGCAGGCTGAG No data
Right 1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG No data
1126908121_1126908127 13 Left 1126908121 15:53389361-53389383 CCTGGCTCTCGGGTCTCAGATAC No data
Right 1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG No data
1126908116_1126908127 27 Left 1126908116 15:53389347-53389369 CCCAGCCACAATAACCTGGCTCT No data
Right 1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG No data
1126908117_1126908127 26 Left 1126908117 15:53389348-53389370 CCAGCCACAATAACCTGGCTCTC No data
Right 1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG No data
1126908120_1126908127 22 Left 1126908120 15:53389352-53389374 CCACAATAACCTGGCTCTCGGGT No data
Right 1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG No data
1126908115_1126908127 28 Left 1126908115 15:53389346-53389368 CCCCAGCCACAATAACCTGGCTC No data
Right 1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126908127 Original CRISPR CAGGCTGAGGAGAGAGTGGA AGG Intergenic
No off target data available for this crispr