ID: 1126908992

View in Genome Browser
Species Human (GRCh38)
Location 15:53398894-53398916
Sequence CAGGCACCTTCCCCTTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126908992_1126908996 -10 Left 1126908992 15:53398894-53398916 CCCTCAAAAGGGGAAGGTGCCTG No data
Right 1126908996 15:53398907-53398929 AAGGTGCCTGGCTCTTATTAGGG No data
1126908992_1126908998 -4 Left 1126908992 15:53398894-53398916 CCCTCAAAAGGGGAAGGTGCCTG No data
Right 1126908998 15:53398913-53398935 CCTGGCTCTTATTAGGGACCAGG No data
1126908992_1126909003 23 Left 1126908992 15:53398894-53398916 CCCTCAAAAGGGGAAGGTGCCTG No data
Right 1126909003 15:53398940-53398962 TTAAGGGAGAAGCCAGAAAATGG No data
1126908992_1126908999 6 Left 1126908992 15:53398894-53398916 CCCTCAAAAGGGGAAGGTGCCTG No data
Right 1126908999 15:53398923-53398945 ATTAGGGACCAGGCCTCTTAAGG No data
1126908992_1126909000 7 Left 1126908992 15:53398894-53398916 CCCTCAAAAGGGGAAGGTGCCTG No data
Right 1126909000 15:53398924-53398946 TTAGGGACCAGGCCTCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126908992 Original CRISPR CAGGCACCTTCCCCTTTTGA GGG (reversed) Intergenic
No off target data available for this crispr