ID: 1126914055

View in Genome Browser
Species Human (GRCh38)
Location 15:53445467-53445489
Sequence GCACACTCAGTATCCAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126914053_1126914055 -8 Left 1126914053 15:53445452-53445474 CCAGGTTCAGCCTAGGCACACTC No data
Right 1126914055 15:53445467-53445489 GCACACTCAGTATCCAACACAGG No data
1126914050_1126914055 24 Left 1126914050 15:53445420-53445442 CCAGAATAATTGCAAAGGGACTC No data
Right 1126914055 15:53445467-53445489 GCACACTCAGTATCCAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126914055 Original CRISPR GCACACTCAGTATCCAACAC AGG Intergenic
No off target data available for this crispr