ID: 1126916723

View in Genome Browser
Species Human (GRCh38)
Location 15:53474170-53474192
Sequence GGTACCTGGATTTGTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126916723_1126916728 7 Left 1126916723 15:53474170-53474192 CCCATAGCACAAATCCAGGTACC No data
Right 1126916728 15:53474200-53474222 TATCTGTTATACCTGTAGCCTGG No data
1126916723_1126916729 12 Left 1126916723 15:53474170-53474192 CCCATAGCACAAATCCAGGTACC No data
Right 1126916729 15:53474205-53474227 GTTATACCTGTAGCCTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126916723 Original CRISPR GGTACCTGGATTTGTGCTAT GGG (reversed) Intergenic
No off target data available for this crispr