ID: 1126919332

View in Genome Browser
Species Human (GRCh38)
Location 15:53503373-53503395
Sequence CTCTTCACAGAGATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126919332_1126919342 30 Left 1126919332 15:53503373-53503395 CCATGTTCCATCTCTGTGAAGAG No data
Right 1126919342 15:53503426-53503448 CAGTGGAGCTTGGAGGGAATGGG No data
1126919332_1126919338 23 Left 1126919332 15:53503373-53503395 CCATGTTCCATCTCTGTGAAGAG No data
Right 1126919338 15:53503419-53503441 TCCATCTCAGTGGAGCTTGGAGG No data
1126919332_1126919340 24 Left 1126919332 15:53503373-53503395 CCATGTTCCATCTCTGTGAAGAG No data
Right 1126919340 15:53503420-53503442 CCATCTCAGTGGAGCTTGGAGGG No data
1126919332_1126919336 13 Left 1126919332 15:53503373-53503395 CCATGTTCCATCTCTGTGAAGAG No data
Right 1126919336 15:53503409-53503431 TTTTTTTCTGTCCATCTCAGTGG No data
1126919332_1126919341 29 Left 1126919332 15:53503373-53503395 CCATGTTCCATCTCTGTGAAGAG No data
Right 1126919341 15:53503425-53503447 TCAGTGGAGCTTGGAGGGAATGG No data
1126919332_1126919337 20 Left 1126919332 15:53503373-53503395 CCATGTTCCATCTCTGTGAAGAG No data
Right 1126919337 15:53503416-53503438 CTGTCCATCTCAGTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126919332 Original CRISPR CTCTTCACAGAGATGGAACA TGG (reversed) Intergenic
No off target data available for this crispr