ID: 1126924255

View in Genome Browser
Species Human (GRCh38)
Location 15:53565133-53565155
Sequence GGGTACAATAAGTGTAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126924255 Original CRISPR GGGTACAATAAGTGTAAGAT TGG Intronic
903345228 1:22680106-22680128 AGGTACAGTTAGTGCAAGATAGG + Intergenic
906888775 1:49683807-49683829 TGGTACAATAAGTTAAAAATAGG + Intronic
910176493 1:84436305-84436327 GGTTACAATGACTGTAAGAGGGG + Intergenic
910616953 1:89208954-89208976 GGGAAAAATAAGTGGGAGATGGG - Intergenic
917626382 1:176850705-176850727 GGGAACAGCAAGTGTAAGGTGGG + Intergenic
919700902 1:200629996-200630018 GGGTAAAAAAAGAGAAAGATGGG - Intronic
920685331 1:208104882-208104904 TGGTACTATAAGTTTAAGACGGG + Intronic
921592939 1:217024627-217024649 GGGGACAATAAAGGAAAGATGGG - Intronic
1068919922 10:62472747-62472769 GAGTACAAAAAATGTAAAATAGG - Intronic
1074344261 10:112666740-112666762 GGCTACAACAAGACTAAGATAGG + Intronic
1074515491 10:114165049-114165071 GGGAGGAATAAGTGTAAGAAAGG + Intronic
1078857967 11:15221728-15221750 GGGTGCAATGAGTGGCAGATGGG - Intronic
1079831202 11:25270391-25270413 GGGTAAAATAAAAATAAGATAGG + Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1088245855 11:107817458-107817480 GGGTAGAATGAGAGTAGGATAGG - Intronic
1092076808 12:5680785-5680807 GGGAACAATAAGAATCAGATAGG + Intronic
1099150006 12:79098685-79098707 GGGTACAACATGTTTATGATTGG - Intronic
1100376452 12:94020317-94020339 GGGGACAATAGTTGTAAGCTGGG - Intergenic
1118821839 14:69350861-69350883 GGGAAGAATAATAGTAAGATAGG - Intronic
1126924255 15:53565133-53565155 GGGTACAATAAGTGTAAGATTGG + Intronic
1136870732 16:33805137-33805159 GGGTAGAATAAGTTTAAGGTTGG - Intergenic
1140744333 16:77968017-77968039 GGGTACATTATCTGTAAAATGGG + Intronic
1141833287 16:86521764-86521786 GGGTTCAGTACGTGCAAGATAGG + Intergenic
1203101440 16_KI270728v1_random:1310921-1310943 GGGTAGAATAAGTTTAAGGTTGG + Intergenic
1144091325 17:11859449-11859471 GGTTACATTAACTGTTAGATTGG - Intronic
1144357705 17:14461737-14461759 GGGTACTATCTTTGTAAGATGGG + Intergenic
1147495404 17:40910901-40910923 GGGAAGAAAAAGTTTAAGATGGG - Intergenic
1152163752 17:78687079-78687101 GTGTACAATAAATGTAATGTAGG - Intronic
1156182850 18:34625945-34625967 GGTTGCATTAAGTGTAGGATGGG + Intronic
1159602234 18:70439529-70439551 TGGTACAAAAAGTAGAAGATTGG - Intergenic
1161498644 19:4600952-4600974 GGGTTCAATAAGTGCTGGATGGG - Intergenic
1164676244 19:30103717-30103739 GGGAACACTGAGTATAAGATGGG + Intergenic
926978950 2:18545996-18546018 GAGTAGACTATGTGTAAGATAGG - Intergenic
928014170 2:27639175-27639197 GTGTACAAGAAGAATAAGATAGG + Intronic
942421382 2:175811646-175811668 GGGTATAACAGGTGTAAGCTGGG + Intergenic
943090627 2:183370349-183370371 AGGTACAATTAGTGTAACTTTGG + Intergenic
1169585407 20:7077867-7077889 GGGTACATTAAATGTAAAAAAGG - Intergenic
954588535 3:51759393-51759415 GAATACAATAAGTGCAAAATAGG - Intergenic
954613560 3:51958463-51958485 GAGAACAATAAGGGGAAGATGGG + Intronic
962417256 3:135194319-135194341 GGGGAAAAAAAGTATAAGATAGG - Intronic
963877943 3:150497746-150497768 GGGGACTATAAGTCCAAGATTGG - Intergenic
964247922 3:154675363-154675385 AGGTTCATTAACTGTAAGATGGG - Intergenic
964286928 3:155128264-155128286 GGGAAAAATAAGGGTAACATTGG - Intronic
965253245 3:166369278-166369300 GGGTTCAATAATTGAAACATGGG - Intergenic
968348285 3:198030275-198030297 GGAAACAAGAAGTGTACGATGGG - Intronic
971032109 4:22650066-22650088 GGCTACATTAAGTAAAAGATGGG - Intergenic
972883527 4:43456068-43456090 GGATACAATCAGTTTAAGAAAGG - Intergenic
979347032 4:119600525-119600547 GGGCACGGAAAGTGTAAGATAGG + Intronic
982532271 4:156559731-156559753 GGGCAGAATAAGTGAAATATAGG - Intergenic
983094323 4:163543736-163543758 GGATAAAATAAATGTAAGAGAGG + Intronic
987379619 5:17272950-17272972 GGGTCCAGTAAGTATAACATGGG - Intronic
987722044 5:21649483-21649505 GGGAAAAATAAGTGAAATATTGG - Intergenic
992075500 5:73189181-73189203 GGGTAGAATAATTGTTAGGTAGG + Intergenic
994154281 5:96485533-96485555 GGGTACCAAAAGTGGAAGAAAGG + Intergenic
997707017 5:135965254-135965276 GGCAACAATAATTTTAAGATAGG + Intergenic
999544482 5:152612124-152612146 AGTTACAATAAGTCTAAGGTAGG - Intergenic
1003935690 6:10973020-10973042 GGGGAGAATAGGTGTTAGATAGG + Intronic
1005707555 6:28470387-28470409 AGGTACAACAACTGTAAGAGAGG + Intergenic
1008533925 6:52492070-52492092 GGTTTCATTAAGTGTAAGATGGG + Intronic
1011563589 6:88649290-88649312 AGGTAAAATAAGGGTATGATGGG + Intronic
1013641813 6:112090957-112090979 GGATACAATAAGTTTCAGTTAGG - Intronic
1021812838 7:24420187-24420209 GGGTAAAATAAGTTGAAGAATGG - Intergenic
1022336780 7:29429537-29429559 TGTTCCAAAAAGTGTAAGATGGG - Intronic
1022414083 7:30163473-30163495 GGATACAATAACTGTAACAAAGG - Intergenic
1027542195 7:79480545-79480567 GGGTAGAACAAATGTAAAATGGG + Intergenic
1029887384 7:103887699-103887721 GGATACAAGAAATGTCAGATGGG + Intronic
1041964564 8:63660118-63660140 GGATACAATAATTGTAATTTGGG + Intergenic
1046396406 8:113646099-113646121 GAGTACATTAAGTGGAAGGTTGG - Intergenic
1047060294 8:121218241-121218263 AGGTACAATAATTTTGAGATTGG + Intergenic
1047711813 8:127559963-127559985 GGATACAAAAAGAGCAAGATAGG - Intergenic
1052124511 9:24758589-24758611 TGGAACCATAAGTGTAAGTTAGG - Intergenic
1188994439 X:36865844-36865866 GGGTATTATGAGTGTAAGCTGGG + Intergenic
1193193803 X:78605862-78605884 GGGTACAACAATAGTTAGATAGG + Intergenic
1194601259 X:95924143-95924165 GGGTACAATGAGAGTGAGACTGG + Intergenic
1194718053 X:97309399-97309421 GGGTATAAAAAATGTAAAATTGG - Intronic
1194771114 X:97906798-97906820 GTGTAAAATAAGTTAAAGATGGG + Intergenic
1195062620 X:101210981-101211003 GGGTAGAGTGAGGGTAAGATAGG + Intergenic
1196830789 X:119773927-119773949 GGATACATTAAGTTTGAGATTGG + Intergenic