ID: 1126924312

View in Genome Browser
Species Human (GRCh38)
Location 15:53565963-53565985
Sequence GAGAAGGAACGCTCTGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126924312 Original CRISPR GAGAAGGAACGCTCTGATTA GGG Intronic
900813918 1:4828736-4828758 GAGAAGGACAGCTCTGCTCAGGG + Intergenic
903400663 1:23044293-23044315 AAGAAGGAGCTCTCTGAATATGG + Intronic
905783388 1:40732447-40732469 TAAAAGGAACACTCTGATTTTGG + Intronic
912600167 1:110922929-110922951 GAGAAGGAGAGCTTTGACTATGG - Intergenic
916385130 1:164258573-164258595 GAGAAGTCATGCTCTAATTAGGG - Intergenic
918234209 1:182562582-182562604 GAGATGGCACTCTCTAATTAGGG + Intergenic
920648222 1:207818510-207818532 GAGAAGAGAAGCTCTGATTTGGG + Intergenic
923963425 1:239108390-239108412 AAGAAAGAACGCTGTGAATAGGG + Intergenic
1064776260 10:18780911-18780933 GAGCAAGAACGCACTGATTGTGG + Intergenic
1065182732 10:23143285-23143307 AATAACGAAAGCTCTGATTAAGG + Intergenic
1067478390 10:46580424-46580446 GAAAAGGAAAGTTCTGTTTATGG + Intronic
1067616348 10:47761363-47761385 GAAAAGGAAAGTTCTGTTTATGG - Intergenic
1072442741 10:95471404-95471426 GAGGAGGAACGCTGAGGTTAGGG + Intronic
1073625600 10:105092814-105092836 GAGAAGGAAACTTCTGATAAAGG + Intronic
1078080536 11:8201580-8201602 GAGAAGGAGGGCTTTGTTTAGGG - Intergenic
1083826887 11:65208968-65208990 GAGGAGAAAAGCTCTGCTTAAGG - Intronic
1085587972 11:77729296-77729318 GAGATGGGACGTTCAGATTAGGG + Intronic
1085844811 11:80052864-80052886 GAAAATGAACACTCTGGTTATGG + Intergenic
1087732838 11:101798020-101798042 GAGAAGGTACGCTTTCATGAGGG - Intronic
1092523478 12:9295394-9295416 GAGAAGGAAAGCTCAGGCTAAGG - Intergenic
1092543818 12:9436505-9436527 GAGAAGGAAAGCTCAGGCTAAGG + Intergenic
1094509127 12:31085546-31085568 GAGAAGGAAAGCTCAGGCTAAGG - Intronic
1098482921 12:70986744-70986766 GAGAAGGAATGGTCTCATTCTGG + Intergenic
1107982109 13:45743837-45743859 GATATGGAAGGGTCTGATTATGG - Intergenic
1108455975 13:50613941-50613963 GTGAAGGAAGGCCCTGAGTATGG + Intronic
1110203264 13:72879364-72879386 GAGAAGGAATGTTCTGAGTTAGG + Intronic
1110384671 13:74895054-74895076 GATAAGGAACGGTCTTACTATGG - Intergenic
1113161934 13:107391657-107391679 GAGAAGGAATGTTCAGGTTAAGG - Intronic
1116313103 14:43351344-43351366 AAGAAGGAACACTCAGAATATGG - Intergenic
1120003677 14:79332770-79332792 TAGAATGAACGCTGTGAATATGG - Intronic
1126924312 15:53565963-53565985 GAGAAGGAACGCTCTGATTAGGG + Intronic
1127069209 15:55271778-55271800 GAGAAGCTACGCTTTCATTATGG + Intronic
1128548390 15:68582353-68582375 GGGAAGGAAGGCTCTGATGCAGG + Intronic
1133070551 16:3243978-3244000 GACAAGGAACCCCCTGCTTAGGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133399932 16:5478308-5478330 GAGAAGGAAGGCTCTGAGCATGG + Intergenic
1138904289 16:61311651-61311673 TAGAAGGAAAGCTCTCTTTAAGG + Intergenic
1143936503 17:10490991-10491013 AAGATGGAAGGATCTGATTATGG - Intergenic
1145258967 17:21343450-21343472 CAGAAGGGACTCTCTGTTTATGG + Intergenic
1145317656 17:21744554-21744576 CAGAAGGGACTCTCTGTTTATGG - Intergenic
1148977079 17:51538976-51538998 GAGAAAGAAAGCTCTTATGAGGG + Intergenic
1151953153 17:77366352-77366374 TAGGAGGAACGCTCTGGTCATGG + Intronic
1156240409 18:35248259-35248281 GAGAAGTAATGCTCTTATTGGGG + Exonic
1157241690 18:46015681-46015703 GAGAAGCATGGCTCTGAGTAAGG + Intronic
1157489328 18:48111298-48111320 GAAAAGGAATGCTTGGATTAGGG + Intronic
1159431004 18:68353418-68353440 GAGAATGAAACCTCTGATAAGGG + Intergenic
927162855 2:20285402-20285424 GAAAAGCAAAGCTCTGAATATGG + Intronic
929352242 2:40971267-40971289 GAGAAGGGACTCTCTGGTAATGG - Intergenic
930379647 2:50611911-50611933 GAGAAGGGAAGATCTGATTGGGG - Intronic
933371924 2:81425286-81425308 GAGAAGGTACTCTCTGCTTGGGG - Intergenic
934501405 2:94862593-94862615 GAGTAGGAACGCTCTCTTAAAGG + Intergenic
934948849 2:98562661-98562683 GAGAAGACAGGCTCTCATTAAGG - Intronic
936895699 2:117425096-117425118 GAGAAGGGACTCTATGAATATGG + Intergenic
943808518 2:192154327-192154349 GAGAGAGGACGCTCTGATTGAGG + Intronic
947462406 2:230314780-230314802 GAGAAGGAATGCACTGCTGAGGG + Intergenic
947471520 2:230405305-230405327 GAGAAGGAATGCACTGTTGAGGG + Intergenic
947683724 2:232061834-232061856 GAGAAGGAACTACCTCATTAAGG + Intronic
1170335999 20:15270844-15270866 GAGGAGGCATGCTCTGAGTAAGG - Intronic
1171892609 20:30729382-30729404 GAGTAGGAACGCTCTCTTAAAGG + Intergenic
1175246389 20:57584850-57584872 GGGAAAGTACGCTCTGATCAGGG + Intergenic
1176415169 21:6470425-6470447 GAGAAGGAAAACTCTAATAATGG - Intergenic
1179690669 21:43078758-43078780 GAGAAGGAAAACTCTAATAATGG - Intergenic
1183801791 22:40172295-40172317 GAGAAGGAACTCACTGAGAAGGG - Intronic
949452148 3:4197572-4197594 GAGAAAGAATGTTTTGATTAAGG + Intronic
951694574 3:25432515-25432537 GAGAAGGAAACTTCTGATTCAGG - Intronic
953498275 3:43407640-43407662 GAGAAGAAACGCTCTGGTTGTGG + Intronic
956944955 3:74210435-74210457 GAGAAGGAAAGCTCAGATTTGGG + Intergenic
958265685 3:91434573-91434595 GCAAAGGAACTCTCTGCTTAGGG - Intergenic
959317669 3:104829022-104829044 AAGAAGAAAAGCTCTGAATAAGG - Intergenic
967982081 3:195071807-195071829 GAGGAGGGACCCTCTGACTAGGG + Intronic
969439248 4:7207676-7207698 AAGAAGGCACATTCTGATTAGGG - Intronic
975931767 4:79532943-79532965 TGGAAGGAAGACTCTGATTAAGG + Intergenic
978475744 4:109127967-109127989 GAGCAGGGACGCTCTTTTTAGGG + Intronic
980973146 4:139585946-139585968 GAGAAGGAAGGCCCTGAGTTAGG + Intronic
983672289 4:170252188-170252210 GAAAAGAAACACTTTGATTAAGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
988883777 5:35532965-35532987 AAGAAAGAACCCTCTGATTCCGG + Intergenic
998441772 5:142168658-142168680 TAGTAGGATCTCTCTGATTAGGG + Intergenic
1012202233 6:96420911-96420933 GAGAAGAAACCATCAGATTAAGG + Intergenic
1020857729 7:13450561-13450583 GACAATGAAAGCTCTAATTAAGG + Intergenic
1028221593 7:88203406-88203428 GAGAAGGAAGTCACTGATGAAGG + Intergenic
1031938332 7:127759956-127759978 GAGAAGGAAGGTCCTGATTGGGG - Intronic
1033095796 7:138429703-138429725 GAGAATGAACACTCAGACTAAGG + Intergenic
1039889248 8:41673113-41673135 GAGAAGCAAGGCTCTGAATTGGG + Intronic
1041809358 8:61890254-61890276 GAGCAGAAAAGCTCTAATTAAGG - Intergenic
1044533486 8:93334305-93334327 GGGAAGGAGCATTCTGATTATGG + Intergenic
1046617763 8:116496294-116496316 CAGAAGGAAAGCTCTTATAAAGG - Intergenic
1052589581 9:30473925-30473947 GAGAAAGAATGCTTTCATTAGGG - Intergenic
1053387169 9:37702054-37702076 GAGAAGATAAGTTCTGATTAGGG + Intronic
1054356215 9:64066354-64066376 GAGTAGGAACGCTCTCTTAAAGG - Intergenic
1054715259 9:68551129-68551151 GTGAATGAAGGTTCTGATTATGG + Intergenic
1055068010 9:72138141-72138163 GAGAAGGAATGTGCTTATTAAGG + Intronic
1056004032 9:82247950-82247972 GAGAAGGAACTCTCCATTTAAGG - Intergenic
1056542105 9:87580843-87580865 GAGAAGCAGTGCTCTGAGTATGG + Intronic
1203561972 Un_KI270744v1:64901-64923 GAGTAGGAACGCTCTCTTAAAGG + Intergenic
1186690208 X:11967451-11967473 GAAAAGCACTGCTCTGATTAAGG - Intergenic
1195430656 X:104785540-104785562 CAGAAGGAAGACTCTGAATAAGG - Intronic
1196999913 X:121427820-121427842 TAGAAGGAACTCTGTGATAAAGG + Intergenic
1198953960 X:142106442-142106464 GAGAAGGAAGGCTCTAAGTGGGG - Intergenic