ID: 1126926428

View in Genome Browser
Species Human (GRCh38)
Location 15:53592638-53592660
Sequence AAATTTCATGCTAAACCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126926428_1126926429 0 Left 1126926428 15:53592638-53592660 CCACATGGTTTAGCATGAAATTT 0: 1
1: 0
2: 1
3: 11
4: 173
Right 1126926429 15:53592661-53592683 AAATTCAGCCAATAATTCCAAGG 0: 1
1: 0
2: 2
3: 19
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126926428 Original CRISPR AAATTTCATGCTAAACCATG TGG (reversed) Intronic
900107198 1:987991-988013 AGAGTTCATGCTTAACAATGAGG + Intergenic
908490887 1:64643134-64643156 AATTTCCATGCAGAACCATGTGG + Intronic
910003212 1:82361752-82361774 AAAATTCTTGCTAAGCTATGAGG - Intergenic
911308263 1:96259164-96259186 AAATTTCATGAGAAAATATGAGG + Intergenic
911970141 1:104424056-104424078 AAATTTCATGGCAAACTCTGGGG + Intergenic
913594811 1:120365092-120365114 AAATTTCAAGATAAATCTTGAGG - Intergenic
913661247 1:121008077-121008099 ATATTTTCTGCTAAACCGTGAGG - Intergenic
914012615 1:143791257-143791279 ATATTTTCTGCTAAACCGTGAGG - Intergenic
914092457 1:144513894-144513916 AAATTTCAAGATAAATCTTGAGG + Intergenic
914165217 1:145169926-145169948 ATATTTTCTGCTAAACCGTGAGG + Intergenic
914306074 1:146419977-146419999 AAATTTCAAGATAAATCTTGAGG - Intergenic
914595978 1:149152832-149152854 AAATTTCAAGATAAATCTTGAGG + Intergenic
914651244 1:149699866-149699888 ATATTTTCTGCTAAACCGTGAGG - Intergenic
916779039 1:168003432-168003454 AAACTTCATGCAAAAGCATAAGG + Intronic
916802656 1:168229386-168229408 AAATTTCATTCTTAACCTTATGG + Intronic
916997865 1:170320778-170320800 AGATTTCATGTTCAACCATGAGG + Intergenic
917495828 1:175539369-175539391 ATCTTTGATGCAAAACCATGTGG - Intronic
918335141 1:183502713-183502735 AACTTTCATTCTAAAGGATGAGG - Intronic
918542366 1:185646227-185646249 AAATATCATGCTAACTCATAAGG + Intergenic
919283576 1:195523151-195523173 AAAGTTGATGGTAAACAATGGGG + Intergenic
921553485 1:216568311-216568333 ACATTTCATGCAAAGCCATCAGG + Intronic
923551950 1:234971068-234971090 AAGTTCTATGCTAACCCATGGGG - Intergenic
1065676557 10:28181359-28181381 AAACTTCATTTTAAACCAGGTGG + Intronic
1067986880 10:51158714-51158736 GAATTTAATTCTAAACCATAAGG - Intronic
1069342788 10:67431784-67431806 TAATTTCATTTTAAGCCATGTGG - Intronic
1071014592 10:80980548-80980570 AAACTTCATTCTTTACCATGTGG + Intergenic
1072600107 10:96917849-96917871 TAATTTCATGCCAAGCCATCTGG - Intronic
1072754995 10:98013737-98013759 AAACTTCAGGCCAACCCATGTGG + Intronic
1079494150 11:21022198-21022220 AAATTGTATGCTGGACCATGTGG + Intronic
1086075776 11:82850341-82850363 ATATTTCATCCTAAACCAGGCGG + Exonic
1086130131 11:83392869-83392891 CAAGTTCATGCCAAACCCTGTGG + Intergenic
1087825799 11:102763467-102763489 CAGTTTCATGCTAAGCCTTGGGG - Intergenic
1089676886 11:120096328-120096350 AAATTTCATGTTCAACTGTGTGG + Intergenic
1093677084 12:21955725-21955747 ATATTTCAAGCTAAACAATGTGG + Intergenic
1093724897 12:22493265-22493287 AAATCACATGCTAAAGCATTAGG - Exonic
1094027786 12:25976891-25976913 AACTTTCGTGCAAAACCAGGAGG - Intronic
1094058534 12:26289724-26289746 AGGTTTCATTCTAAACCATGGGG + Intronic
1098239457 12:68451953-68451975 AAATTTCTTGCTAAATCAGCTGG + Intergenic
1099854987 12:88152447-88152469 AAATCTCATGCTGAAATATGAGG - Intronic
1101832298 12:108268413-108268435 AACTAACCTGCTAAACCATGTGG + Intergenic
1107196566 13:37659547-37659569 AAATGTCAAGCTAAAGAATGTGG + Intronic
1107680838 13:42848393-42848415 AAATTGCAAGCTGAACCGTGTGG + Intergenic
1108234426 13:48388512-48388534 AATTTTCATCATAATCCATGAGG + Intronic
1109977250 13:69854483-69854505 AAACTTCATGGTAACCAATGTGG - Intronic
1111231634 13:85351869-85351891 ACATATTATGCTAAACAATGTGG - Intergenic
1116150370 14:41133859-41133881 AAATATCATGCTAAATAATGTGG + Intergenic
1118916475 14:70111735-70111757 AAAGTGCATGCGAAAACATGTGG + Intronic
1122731650 14:103804117-103804139 AAATATCATACTAGACCATAAGG + Intronic
1123064449 14:105609909-105609931 AAATAAAATGCTAAACCAAGGGG + Intergenic
1126926428 15:53592638-53592660 AAATTTCATGCTAAACCATGTGG - Intronic
1131240156 15:90733418-90733440 AATTTTCCTGTTAAACCATTTGG - Intronic
1131658555 15:94488046-94488068 TAATTTCATCCTTAACCAAGTGG - Intergenic
1133583756 16:7171560-7171582 AAATTACATTCTAAACACTGAGG - Intronic
1135551694 16:23403521-23403543 GAAATTCATGCTAAGCAATGAGG + Intronic
1140285014 16:73594903-73594925 CAATTTCATCTTTAACCATGTGG + Intergenic
1140295759 16:73708116-73708138 AAATCTCATGCACAACCATTTGG - Intergenic
1144539850 17:16130339-16130361 AACCTTCATCCTAGACCATGTGG - Intronic
1149077972 17:52618772-52618794 AAATTCACTCCTAAACCATGAGG - Intergenic
1150480555 17:65505686-65505708 AAATTTTATGCTAAACTGTATGG - Intergenic
1151364277 17:73606995-73607017 AATATTCAAGCTAGACCATGAGG + Intronic
1153604756 18:6821312-6821334 AAATTTAATTTTAAACCTTGTGG + Intronic
1154337152 18:13474900-13474922 TCAGCTCATGCTAAACCATGAGG - Intronic
1155499458 18:26472482-26472504 AAAATTCATACTAAAGCATACGG + Intronic
1158110785 18:53939423-53939445 AAATTTCATGCTAAACTATTTGG + Intergenic
1159285950 18:66352019-66352041 AGATTTCATACTAAATCCTGTGG + Intergenic
1160241395 18:77125960-77125982 AAATTTCCGGTGAAACCATGTGG - Intronic
1162854869 19:13460515-13460537 AAATTTCAGCCTAATGCATGTGG + Intronic
1164560088 19:29285511-29285533 AAATTGCATCATAAACTATGTGG - Intergenic
1165333092 19:35152202-35152224 AAAGATGATGCTAAACCGTGGGG + Intronic
925324010 2:3001844-3001866 TAATTTGATGCAAAAGCATGCGG - Intergenic
925603507 2:5634438-5634460 AAATTTCAAGATAAATCTTGAGG - Intergenic
926527490 2:13999254-13999276 AAATTTAATGATAAACCCAGAGG - Intergenic
927790681 2:26007077-26007099 TAATTAAATGCTAAACTATGTGG - Intergenic
928131377 2:28653766-28653788 AAATGTCTTGCTAATCCATATGG + Intergenic
930822418 2:55660156-55660178 AAATTTCATGCTGCACTACGAGG - Exonic
931904561 2:66828531-66828553 AAATGTCATTCTCAACAATGGGG + Intergenic
932694269 2:73941273-73941295 AAACTTCATGAGAAACCCTGAGG + Intronic
933441607 2:82321679-82321701 AAATTTTTTGTTAAGCCATGGGG + Intergenic
936988860 2:118340714-118340736 AAACTGCATGCTAGACCAAGTGG - Intergenic
938653042 2:133403404-133403426 AAATTACTTGCTACACCCTGTGG - Intronic
942280096 2:174353268-174353290 ATATTTCATTTTAAACCAAGAGG + Intronic
942558362 2:177195545-177195567 TAATTTCAAGTTATACCATGGGG + Intergenic
944083542 2:195817796-195817818 AAACTTCATGATAACCCCTGAGG - Exonic
944675416 2:202031713-202031735 AAATTTCATGCTTATTCATCAGG - Intergenic
946379569 2:219336530-219336552 ATTTTTCATTATAAACCATGTGG + Intergenic
947099368 2:226603317-226603339 AATTTTAATGCTAATCCATAAGG + Intergenic
947700621 2:232231302-232231324 TAATTGAAAGCTAAACCATGTGG + Intronic
1169768086 20:9170593-9170615 ATATTTCAGGCTAAATGATGAGG - Intronic
1169977017 20:11340942-11340964 AAATTTCATGCAAGAACAAGAGG + Intergenic
1173368058 20:42406049-42406071 CAATTTCATGCCAAAACACGTGG + Intronic
1177509548 21:22067116-22067138 AATTGTCATTCTAAACCCTGGGG + Intergenic
1177597979 21:23270566-23270588 AAATATGATGCTAAAACAAGTGG - Intergenic
1178140322 21:29675620-29675642 AAGCTTCATGCTAAGCCCTGGGG + Intronic
1178409694 21:32353005-32353027 AAAATTCATGCAACTCCATGAGG + Intronic
1178812546 21:35897442-35897464 AAAATTCATGTTAATCAATGGGG + Intronic
1180686642 22:17672690-17672712 ATACTTCATAATAAACCATGTGG - Intronic
1181504209 22:23340536-23340558 AAATTTCATAATAAAACATTAGG + Intergenic
1181655319 22:24293148-24293170 AAATTTCATAATAAAACATTAGG + Intronic
1181709202 22:24670772-24670794 AAATTTCATAATAAAACATTAGG + Intergenic
1182497265 22:30718429-30718451 AAATTTGATGGGAAACCATCTGG + Intronic
949890777 3:8732407-8732429 AAATGTCATACTAAAGAATGTGG - Intronic
955513241 3:59701808-59701830 AAATTTCCTCCTAAACCATTAGG - Intergenic
957782180 3:84833990-84834012 AAAATTCAGTCTAAACCAGGTGG - Intergenic
958652500 3:96955333-96955355 AAAATTCATGTTAAACTATATGG - Intronic
959216183 3:103453218-103453240 TAATTGTATCCTAAACCATGTGG + Intergenic
959327817 3:104959288-104959310 AAATTTCATGATGAAAAATGAGG - Intergenic
960725791 3:120668458-120668480 AAATGTCATGGTAAACAAAGGGG + Intronic
960821021 3:121731642-121731664 AGCTTTCTTGATAAACCATGTGG + Intronic
962197594 3:133377572-133377594 CAATTTCATGCTCCACCAAGTGG + Intronic
964974797 3:162605847-162605869 AAATTTGCAGCTCAACCATGTGG + Intergenic
965137804 3:164795410-164795432 ACATTTGATTCTAAACCTTGAGG + Intergenic
970659277 4:18265557-18265579 AAATTTGCAGCCAAACCATGTGG - Intergenic
971754775 4:30693177-30693199 AAACTTCATGCCAACCCATGAGG - Intergenic
972060273 4:34861098-34861120 CAATATCATGCTTAACAATGAGG + Intergenic
972401209 4:38705436-38705458 AAGTTTAATGATAAACGATGAGG - Intergenic
974606393 4:64157147-64157169 AAATTTGCAGCTATACCATGTGG - Intergenic
974730356 4:65856521-65856543 CAATGTCATGCCAAAGCATGTGG - Intergenic
974810822 4:66943753-66943775 AGATTTCATGGTAAATGATGAGG + Intergenic
977417806 4:96757177-96757199 AAATTTCTTGCTTAACTATTAGG + Intergenic
978584664 4:110264292-110264314 AAATATCAAGATCAACCATGGGG - Intergenic
979305418 4:119136952-119136974 AGAAATCAAGCTAAACCATGTGG - Intronic
979732252 4:124039039-124039061 GAATTCCATGCTGATCCATGCGG + Intergenic
980191794 4:129533805-129533827 CAATTTTATGCAAAAGCATGTGG - Intergenic
980650710 4:135711670-135711692 AAATTTACAGCTTAACCATGAGG + Intergenic
980975644 4:139607610-139607632 ATTTTTCATGCTAAAGCATCTGG - Intergenic
981053503 4:140335523-140335545 TAATTTCATGCGAAACTATTTGG - Intronic
982581305 4:157182344-157182366 GCAATTCTTGCTAAACCATGGGG - Intergenic
983313988 4:166103019-166103041 AAATTCCATGCTACACTTTGAGG + Exonic
984153994 4:176171618-176171640 AAGTTTGTTGCTAAACAATGTGG - Intronic
984276165 4:177612567-177612589 ACATTTCTTGTTAAACAATGTGG - Intergenic
988906084 5:35790915-35790937 ACATTTCATGCTAAATCCTCAGG + Intronic
989410533 5:41115170-41115192 AAATTTCAATCAAAACCATGTGG + Intergenic
991434023 5:66577671-66577693 AGATTTCATGCATAACCCTGTGG + Intergenic
992931395 5:81651062-81651084 AATTTTGAAGCTACACCATGTGG + Intronic
993973757 5:94451466-94451488 AAATTTTATGCAAATTCATGAGG - Intronic
994835472 5:104846541-104846563 AAATTTGATGATAAACCTTTGGG + Intergenic
997031960 5:130140644-130140666 AGATTCCATTCTAAACAATGAGG - Intronic
998625578 5:143842018-143842040 AAAGTTCATGCGAATCAATGAGG + Intergenic
1000508531 5:162152418-162152440 AAATTTCCTGCTAGACCAGTTGG - Intronic
1004537194 6:16514571-16514593 AGATTTGATCCTAAACCTTGGGG + Intronic
1005853573 6:29842190-29842212 AATTTTCATCAGAAACCATGGGG - Intergenic
1006103927 6:31704625-31704647 AAATTTAATGATAAAGCAAGTGG + Intronic
1008323252 6:50144292-50144314 ATATTTCATCATAAAACATGAGG - Intergenic
1008569539 6:52802910-52802932 AAATTTCCTGTTAATCCAGGTGG - Intronic
1009755610 6:67936159-67936181 ATAGTTCATTGTAAACCATGGGG - Intergenic
1012723548 6:102780200-102780222 TCATTTAATGCTAAAACATGTGG + Intergenic
1013509039 6:110827869-110827891 AAATTTCATTCTTAAACATTAGG + Intronic
1013577066 6:111494313-111494335 AAATTCTATGTTAAACGATGTGG + Intergenic
1015823533 6:137288122-137288144 AAAATTCATGAAAAACCCTGCGG - Intergenic
1016076602 6:139804078-139804100 AAATTCCAAACTAAAACATGAGG + Intergenic
1018831162 6:167444657-167444679 AAATGTCTTGCTAAACTGTGAGG + Intergenic
1025107940 7:56188246-56188268 AAATTCCATCCTAAAACATGTGG - Intergenic
1027174484 7:75894414-75894436 TAATTTCATGAGAAACCATAAGG - Intergenic
1027650180 7:80856912-80856934 AATTTTCATTCCAAATCATGGGG - Intronic
1027722814 7:81766882-81766904 GAAGGTCATGCTCAACCATGTGG - Intronic
1030816517 7:114046197-114046219 AACTTTTTTGCTAAATCATGAGG - Intronic
1031795936 7:126174916-126174938 AAATTTCCAGCTCAGCCATGTGG + Intergenic
1032636735 7:133717486-133717508 AAAATTTATGCAGAACCATGGGG - Intronic
1040887988 8:52285914-52285936 ACACTTCACCCTAAACCATGTGG + Intronic
1041535537 8:58921431-58921453 ACATTTCATAGTTAACCATGTGG - Intronic
1041654837 8:60338473-60338495 AAATTTTATGCTAAATAAAGGGG - Intergenic
1043242229 8:77948954-77948976 AAACTTCATGATAGGCCATGTGG - Intergenic
1044504728 8:93004581-93004603 AAATTTGCGGCTCAACCATGGGG - Intronic
1046046921 8:108975570-108975592 AAGTTTCTTGCTGAACCTTGGGG + Intergenic
1051350454 9:16193610-16193632 ATCTTTCAGGCTAAAACATGGGG + Intergenic
1051817341 9:21123528-21123550 TAATTTTATCCTAAACCATGTGG + Intergenic
1052500408 9:29281865-29281887 AAATTCCATTCTAACACATGGGG + Intergenic
1053514579 9:38719771-38719793 AAATTTCATGTTAAAGAGTGTGG - Intergenic
1053535990 9:38926809-38926831 GAATTTCATGATGTACCATGCGG - Intergenic
1054630143 9:67437143-67437165 GAATTTCATGATGTACCATGCGG + Intergenic
1054707282 9:68475771-68475793 AAAATTCATTCAAAACCTTGTGG - Intronic
1056279376 9:85025890-85025912 AAATGTCATTCTAAAGAATGAGG + Exonic
1056521848 9:87408980-87409002 AATTTTGATGCTAAATCAAGAGG + Intergenic
1058551662 9:106121704-106121726 AAATCTAATGCTAATCCATGAGG + Intergenic
1186715098 X:12243216-12243238 AAATCTCATGTTAAAACACGAGG - Intronic
1188412396 X:29889885-29889907 AAATTTCATACTAAATCAAATGG - Intronic
1190571516 X:51787000-51787022 AAATTTCATGGCAAAGAATGTGG - Intergenic
1194819974 X:98492987-98493009 AAAATTCATGCTAAGGCAAGAGG + Intergenic
1196940575 X:120771905-120771927 ATATTGCATGCTAGGCCATGGGG - Intergenic
1197643818 X:128995688-128995710 AAATGTCATGCTAAGGAATGTGG + Intergenic
1199373713 X:147083069-147083091 AAATATCAAGCTTAACCACGTGG + Intergenic
1200423316 Y:2996184-2996206 AAATTTTATACCAAACAATGAGG - Intergenic
1202272200 Y:23083163-23083185 GAAATGCATGCTAAACCATTGGG - Intergenic
1202293826 Y:23337519-23337541 GAAATGCATGCTAAACCATTGGG + Intergenic
1202425197 Y:24716907-24716929 GAAATGCATGCTAAACCATTGGG - Intergenic
1202445592 Y:24953178-24953200 GAAATGCATGCTAAACCATTGGG + Intergenic