ID: 1126929057

View in Genome Browser
Species Human (GRCh38)
Location 15:53626463-53626485
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 5, 2: 67, 3: 136, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126929049_1126929057 17 Left 1126929049 15:53626423-53626445 CCGGATCCAAGGGATGGAAGTCA 0: 2
1: 1
2: 1
3: 11
4: 163
Right 1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG 0: 1
1: 5
2: 67
3: 136
4: 223
1126929047_1126929057 22 Left 1126929047 15:53626418-53626440 CCCTGCCGGATCCAAGGGATGGA 0: 2
1: 0
2: 1
3: 6
4: 83
Right 1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG 0: 1
1: 5
2: 67
3: 136
4: 223
1126929048_1126929057 21 Left 1126929048 15:53626419-53626441 CCTGCCGGATCCAAGGGATGGAA 0: 2
1: 0
2: 3
3: 8
4: 72
Right 1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG 0: 1
1: 5
2: 67
3: 136
4: 223
1126929051_1126929057 11 Left 1126929051 15:53626429-53626451 CCAAGGGATGGAAGTCAGCGGCA 0: 1
1: 2
2: 1
3: 9
4: 113
Right 1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG 0: 1
1: 5
2: 67
3: 136
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907159454 1:52359986-52360008 TGGTAATGAACAGTGGTGGCAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909850088 1:80450975-80450997 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911699915 1:100940909-100940931 CAGCCAAGCACAGTGGTGGCAGG - Intronic
913132730 1:115856801-115856823 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
914044041 1:144076996-144077018 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
914134016 1:144883472-144883494 CGGCAAAAAGCCGTGGTGGCGGG + Intergenic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918951491 1:191145919-191145941 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919133649 1:193481891-193481913 AGGCAAAGAACAGTGTTGATTGG + Intergenic
920016358 1:202912810-202912832 CAGCCAAGCACAGTGGTGGCAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924132097 1:240920691-240920713 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067455509 10:46416496-46416518 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1067631695 10:47968139-47968161 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1067828584 10:49597089-49597111 CAGGAAAGCACAGAGGTGGAGGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074164610 10:110864046-110864068 CTGCAAAGTGCAGTGGTGGCCGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077651016 11:3972700-3972722 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1077803933 11:5571146-5571168 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1078307859 11:10208567-10208589 CAGGAAAGAACACAGGTGGAGGG + Intronic
1079582259 11:22080363-22080385 GGGCTAGGAATAGTGGTGGATGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1079962165 11:26938046-26938068 AGGAAAAGAAAAGTGGTTGAAGG - Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081711009 11:45215367-45215389 TGGCCAAGAACTGTGGAGGATGG - Intronic
1081739957 11:45431898-45431920 CCTCAAAGCACAGTGGTGAAGGG - Intergenic
1084462518 11:69303814-69303836 CAGCGAAGACCAGTGGTGGTCGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085161966 11:74355810-74355832 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1087503501 11:98990834-98990856 CAGCAAAGAACAGTGCTAAAGGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1090316103 11:125790130-125790152 AGGCTGAGAAGAGTGGTGGAAGG + Intronic
1091772038 12:3158415-3158437 ATGCAAGGAACAGTGGAGGACGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093890032 12:24508761-24508783 GGGCAAAGAACAGTGGGCTAAGG + Intergenic
1093899043 12:24608554-24608576 CAATAAAGAACAGTGGTGTAGGG + Intergenic
1094008116 12:25777230-25777252 CAGCAAAGCACAGTGGAAGATGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096734849 12:53644635-53644657 CCCCAAAGGACAGTGGTGAAGGG + Intronic
1096754668 12:53789066-53789088 CAGCCAAGATCAGGGGTGGAAGG - Intergenic
1096826735 12:54284623-54284645 CAGCCAAGCACAGTGGTGGCAGG + Exonic
1096860988 12:54527961-54527983 TGGAAAAGAGCAGTGGTTGAGGG + Intronic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097743481 12:63272421-63272443 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1097882353 12:64697974-64697996 AGGGCAAGAACAGGGGTGGAGGG - Intergenic
1098462787 12:70751324-70751346 TGGCATAGAACAGGGGTGGGTGG - Intronic
1098554358 12:71802013-71802035 TGGAAAAGAACAAAGGTGGAGGG - Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100256113 12:92884782-92884804 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1100816913 12:98395662-98395684 CACCAAAGAAGAGTGGTGGAGGG + Intergenic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1102741717 12:115213522-115213544 CTGCAAAGAAAAATAGTGGAAGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108667107 13:52643534-52643556 CAGCCAAGCACAGTGGTGGCAGG + Exonic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1114355868 14:21907574-21907596 TGGCAAAGAAAAATGGTCGAAGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1116804156 14:49475358-49475380 AAGCAAAGAACAGTGGCAGAGGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117780056 14:59222952-59222974 CCTCAAAGGACAGTGGTGAAGGG - Intronic
1118843016 14:69526881-69526903 CGGTAAAGTGCAGGGGTGGAAGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119708724 14:76805488-76805510 TGGCAAGGCACAATGGTGGAAGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123220508 14:106851262-106851284 CGGGAAAGAACTGGAGTGGATGG - Intergenic
1123790172 15:23711821-23711843 AGGCAAGGAGGAGTGGTGGAAGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125275756 15:37989707-37989729 CTACAAAGAACAGTTTTGGAAGG + Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130643713 15:85704426-85704448 CGCCAAAGATCTGTGGTGGTTGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132131474 15:99284513-99284535 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1132942664 16:2515651-2515673 GGGCAAAGAACAGAGGAGGCTGG - Intronic
1135388744 16:22070189-22070211 CAGCAAAGAACAGTGAAGCACGG + Intronic
1136867816 16:33770674-33770696 CGGCAAAAAACAGCGGCGGCGGG - Intergenic
1137299955 16:47139379-47139401 AGGAAAATAACAGTGGTGGCAGG - Intronic
1137841721 16:51646859-51646881 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1138274255 16:55720345-55720367 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1138924200 16:61570600-61570622 TGGCAAAGAACATGGGTGCAGGG + Intergenic
1140504226 16:75460393-75460415 CGGCAACGCACAGAGGAGGAGGG - Intronic
1140949579 16:79803415-79803437 GGGAAGAGTACAGTGGTGGAGGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1203104351 16_KI270728v1_random:1345574-1345596 CGGCAAAAAACAGCGGCGGCGGG + Intergenic
1203129163 16_KI270728v1_random:1616794-1616816 CGGCAAAAAACAGCGGCGGCGGG - Intergenic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150449800 17:65257339-65257361 CGGCAACAAACTGTTGTGGATGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156003429 18:32412113-32412135 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159777386 18:72619308-72619330 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1162600662 19:11665968-11665990 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164866769 19:31610875-31610897 AGGCAGAAAACAGTTGTGGAAGG - Intergenic
1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG + Intronic
1165560161 19:36672124-36672146 CCCCAAAGAACAGTGGTGAAGGG + Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168367998 19:55805897-55805919 TGGCCAAGAACAGTTCTGGAAGG - Intronic
1202683272 1_KI270712v1_random:29309-29331 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934166825 2:89301605-89301627 AGGCAGAGAACAGAGGTTGAAGG - Intergenic
934200455 2:89880852-89880874 AGGCAGAGAACAGAGGTTGAAGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
939627200 2:144492386-144492408 TGACAAAGAAGAGTGGAGGAAGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
942046578 2:172102551-172102573 CGGGAAAGAGCAGAGGTGGCGGG + Exonic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
944573100 2:201064130-201064152 CAGCCAAGCACAGTGGTGGCAGG + Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
1168840772 20:908673-908695 CCTCAATAAACAGTGGTGGAAGG + Intronic
1169984734 20:11431235-11431257 AAGCAGAGAACAGTAGTGGATGG - Intergenic
1171253789 20:23670674-23670696 AGGCAAAGATCTATGGTGGATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173779766 20:45745630-45745652 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1174857642 20:54061877-54061899 TGGCAAAGAACAGCGGTGGCTGG + Intronic
1175078165 20:56393227-56393249 CCGGATAGAACAGTGGTGTAGGG + Intronic
1176962123 21:15170892-15170914 TGGCAAAGAACAGTGTTTAAAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177450471 21:21258978-21259000 CGGCCACGAACAGATGTGGAGGG + Intronic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179005178 21:37507663-37507685 GGGCAAAGAAAAGGGGTGGGGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1184282841 22:43448521-43448543 CGGCAAAGAAAAGTGGAGTCAGG + Intronic
1184300659 22:43557083-43557105 CTGGAAAGAACACAGGTGGATGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951591925 3:24275670-24275692 CGGCAAAAACCAGAGTTGGATGG - Intronic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
955064701 3:55524337-55524359 CAGGAAGGAACAGTGGTAGAAGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955688150 3:61564552-61564574 AGGGAAAGGACAGTGGTGGGAGG + Intronic
956612327 3:71136669-71136691 CAGCAAAAAACAGTTGTTGATGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959905113 3:111702712-111702734 AGGCAAGGATCAGTGGTGCAGGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961452533 3:127008867-127008889 GGGCACAGGACAGCGGTGGAGGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963331011 3:143916239-143916261 CGGGGAAGAATAGTGGAGGAAGG + Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963664509 3:148166236-148166258 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
963830339 3:150000779-150000801 GGGCCAAGCACAGTGGTGGCAGG + Intronic
964356511 3:155855970-155855992 CAGAAAAGAACAGTGTTGGCCGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
972131606 4:35842437-35842459 CTGCAAAGAACAGTGAATGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975639995 4:76490853-76490875 TGGGAAAGAACTGTGTTGGAGGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976892179 4:90063216-90063238 GGGAAAAGGAGAGTGGTGGAGGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977618439 4:99109817-99109839 TGGCAGCAAACAGTGGTGGACGG + Intergenic
978046040 4:104128924-104128946 AGGCAAACAACTGTGGAGGATGG + Intergenic
978126150 4:105137509-105137531 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
980999776 4:139817646-139817668 CGGCATAGAAAACTGATGGAGGG - Intronic
982886242 4:160786398-160786420 CTACAAAAAACAGTTGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985570237 5:640851-640873 CGGCACTGCCCAGTGGTGGAGGG - Intronic
986022571 5:3818728-3818750 TGGCAAAGGACAGTGGTGAGTGG + Intergenic
986283830 5:6345590-6345612 CAGCAGAGAACAGAGGAGGAGGG + Intergenic
986805440 5:11304596-11304618 GGACAAGGAACAGTGGTGGGAGG + Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989506451 5:42231361-42231383 CGGCAAAGTATAGTGGAGGCGGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991342364 5:65625212-65625234 CGGCAAAGGACAGAGCAGGAGGG - Intronic
991542920 5:67749333-67749355 CTACAAAGAACAGTGCTGGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992808120 5:80358976-80358998 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
993059824 5:83025845-83025867 GGGCAAAGAACAGGGCTGGCCGG + Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995359012 5:111271927-111271949 CGGGAGAGAAAAGTGTTGGAGGG - Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
997759350 5:136429940-136429962 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
998368492 5:141646202-141646224 AGGCAGAGAACAGGGGTGGGTGG + Intronic
998939787 5:147268990-147269012 CAGTAAAGAACAGTGTTGGAGGG + Intronic
1003379335 6:5609126-5609148 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1003721440 6:8707523-8707545 GGGAAATGATCAGTGGTGGAAGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004925964 6:20415412-20415434 GGGCAGTTAACAGTGGTGGAGGG + Intronic
1005255896 6:24002508-24002530 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005610934 6:27524424-27524446 CAGCCAAGCCCAGTGGTGGAAGG + Intergenic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006204265 6:32326257-32326279 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1007416324 6:41693602-41693624 CGGGAAGGCACAGTGGTGGTGGG - Intronic
1007910965 6:45513660-45513682 AGGGAAAGAAGAGGGGTGGAGGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1011889967 6:92145959-92145981 AGGTAAAGAACAGTTATGGAGGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014107103 6:117578435-117578457 TGGCAGAGCACAGTGATGGAAGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014685171 6:124488586-124488608 AAGCAAAGCACAATGGTGGAGGG + Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016633788 6:146263945-146263967 CTGCAAAGAACAGTGTTCTAAGG - Intronic
1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG + Exonic
1018944129 6:168333992-168334014 CGCCTAAGAACGGTGGTGGTTGG - Intergenic
1019303971 7:323638-323660 AGGCAAAGAACACAGGCGGAGGG - Intergenic
1019891188 7:3948556-3948578 CTTAAAAGAACAGTGGTGGCCGG - Intronic
1020605537 7:10332317-10332339 CTGCAAAGGAGAGTGGTGGCTGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022089183 7:27096588-27096610 GCGCATAGAACCGTGGTGGAGGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024156766 7:46633986-46634008 AGGCAATGAGCAGTGGAGGAAGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1027964210 7:84984588-84984610 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028469954 7:91195025-91195047 GAGCAAAGAACAGTGGTTGCAGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035161409 7:156952878-156952900 CGTCTAAGGACAGTGTTGGAAGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1038324191 8:26560016-26560038 AGGCAAAGGAAAGTGGAGGAAGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040631603 8:49219632-49219654 CGGTAAAGCACAGTGCTGGCAGG - Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043589284 8:81808812-81808834 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1043628236 8:82291523-82291545 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046424572 8:114030113-114030135 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1046566301 8:115905507-115905529 CGGCTAAGAATAATGGTGAATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049491281 8:142904457-142904479 TGGCAAAGAACAGTGGGGGTTGG - Intronic
1050316912 9:4411761-4411783 CGGCATAAGACTGTGGTGGATGG - Intergenic
1050373229 9:4944569-4944591 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1051546693 9:18283567-18283589 CTGCAAACCACAGTGGTTGAAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056645759 9:88410428-88410450 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1058041975 9:100312595-100312617 CTGCAAAAAACAGTGGAGAATGG - Intronic
1062459397 9:136656614-136656636 CCGCAAGGCACAGTGGTGGGGGG - Intergenic
1186236202 X:7513619-7513641 TTGCAAGGCACAGTGGTGGAGGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189644288 X:43109860-43109882 CGGCAAAGAACAATGATGTTAGG + Intergenic
1189954702 X:46265321-46265343 GCTCAAAGAGCAGTGGTGGAGGG + Intergenic
1190678627 X:52804852-52804874 CTGCACAGAACAGCGGTCGAGGG + Intergenic
1191001356 X:55663016-55663038 CAGCATAGAACAGCGGTGCAGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192801799 X:74472914-74472936 TAGCAAAGCACAGTGGTGGCAGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192910695 X:75601512-75601534 CAGCAATGAACACAGGTGGATGG - Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196763475 X:119221823-119221845 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197406301 X:126055910-126055932 TGGAAAAGAACAGTGGGGAAAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198111891 X:133509344-133509366 GGGCTGAGTACAGTGGTGGAGGG + Intergenic
1199293688 X:146133787-146133809 CTGCAAAGAACAAAGTTGGATGG - Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201798480 Y:17927131-17927153 CCGTGAAGAACAGTGGTGAAGGG + Intergenic
1201803073 Y:17978826-17978848 CCGTGAAGAACAGTGGTGAAGGG - Intergenic
1201905226 Y:19080314-19080336 TGGCAAAGAGCATTGCTGGATGG - Intergenic
1202359800 Y:24095821-24095843 CCGTGAAGAACAGTGGTGAAGGG + Intergenic
1202510978 Y:25574293-25574315 CCGTGAAGAACAGTGGTGAAGGG - Intergenic