ID: 1126929793

View in Genome Browser
Species Human (GRCh38)
Location 15:53634806-53634828
Sequence CAACCAAGGTGGTGCCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126929788_1126929793 19 Left 1126929788 15:53634764-53634786 CCAAGGAACAATAAAGCAAAGTA 0: 1
1: 0
2: 2
3: 28
4: 289
Right 1126929793 15:53634806-53634828 CAACCAAGGTGGTGCCAGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 110
1126929790_1126929793 -10 Left 1126929790 15:53634793-53634815 CCTTGCACTTTCACAACCAAGGT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1126929793 15:53634806-53634828 CAACCAAGGTGGTGCCAGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126929793 Original CRISPR CAACCAAGGTGGTGCCAGTA GGG Intronic
902650035 1:17831156-17831178 CAACCATGGGGGTGGCAGTGGGG - Intergenic
902876713 1:19344784-19344806 CAAACAACGTGGTGACAGGAGGG + Intronic
910617008 1:89209446-89209468 CAAGCAAGGTGTTCCCAGTCAGG - Intergenic
914378549 1:147095138-147095160 CAGCCAAGGTGGTGCCTTTCTGG - Intergenic
915403383 1:155640713-155640735 CAACCAAGGAGGTCTCAGGAAGG - Intergenic
916440384 1:164819206-164819228 GAACCTGGGTGGTGCCAGGATGG + Intronic
916954358 1:169816219-169816241 AAACCAAGCTGATTCCAGTATGG + Intronic
918193175 1:182196033-182196055 AAATCAAGGTGTTGCCAGGATGG + Intergenic
918343197 1:183583991-183584013 CAACCAAGGCAGTGCTAGTGGGG + Intronic
919417931 1:197334561-197334583 CATCCAAGATGGTGCCATGAAGG - Intronic
921186779 1:212677381-212677403 CAAACAAGGTGGTGCCTGTGGGG + Intergenic
1066618906 10:37323697-37323719 CAATGAAGGTGATGCCACTAGGG + Intronic
1067501105 10:46806068-46806090 CAATCAAGGTGGTGGCTGGAAGG + Intergenic
1067593478 10:47533847-47533869 CAATCAAGGTGGTGGCTGGAAGG - Intronic
1067640587 10:48041951-48041973 CAATCAAGGTGGTGGCTGGAAGG - Intergenic
1068855866 10:61796647-61796669 AAACCAAGGTGGTTACAGTGTGG - Intergenic
1070524480 10:77283434-77283456 TAACCAAGATGGTGCCTGTCAGG + Intronic
1070793618 10:79204216-79204238 CAACCAAGGTGAGGGCAGGAAGG - Intronic
1070887007 10:79909739-79909761 CAACCAAGGCGGTGTCAAGATGG - Intergenic
1073378164 10:103054832-103054854 CAAACAAGCTGGTGCCAGGCTGG - Intronic
1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG + Intronic
1079253960 11:18810394-18810416 CAATGAGGGTGGTGTCAGTATGG - Intergenic
1082250728 11:49977267-49977289 CAGCCCTGGTGTTGCCAGTAAGG + Intergenic
1084029035 11:66470195-66470217 CAACCAGTGGGGTGCCAGGAAGG - Intronic
1085393607 11:76194937-76194959 TAACCAAGGTGACGCCAGCAGGG + Intronic
1086206378 11:84262940-84262962 CAACCCAGGTGGTTCCTGCATGG + Intronic
1088154719 11:106789754-106789776 CCACCAAGGTGGTACCTCTATGG - Intronic
1090725860 11:129526723-129526745 CCACTGAGGTGGGGCCAGTAAGG + Intergenic
1090829844 11:130413620-130413642 AAACCAAGGCAGTGCCAGTGAGG - Intronic
1093659187 12:21734976-21734998 CAACCATGGTGGAGACAGTGTGG + Intronic
1096037689 12:48486929-48486951 CAAACAAGTGGGTGCCAGGAAGG - Intronic
1100275031 12:93064036-93064058 GGACCAGGGTGGAGCCAGTAGGG - Intergenic
1102392764 12:112562919-112562941 CACCCAGGATGGTGGCAGTAGGG - Intergenic
1106483810 13:30155701-30155723 CATCCAAGGTGGTGCCCGGGTGG + Intergenic
1109044224 13:57387494-57387516 CAACCAAGGGGGTGCCATAAAGG + Intergenic
1111739799 13:92189391-92189413 CAACTAAGGTGGGGACAGAACGG - Intronic
1112169068 13:96950950-96950972 CAACTAAGGTAGTGCCAGAGTGG + Intergenic
1112379334 13:98873628-98873650 CATCCATGCTGGAGCCAGTAGGG - Intronic
1113215854 13:108039926-108039948 CTACCAAGTTTGTCCCAGTAAGG + Intergenic
1114671420 14:24413373-24413395 CATCCAAGGTGGGGCCATCACGG - Exonic
1116563266 14:46411340-46411362 AAACCAAGGTGCTGCCAATGGGG - Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1121931557 14:97977094-97977116 CCACCAGGGTGGGGCAAGTATGG - Intronic
1122999958 14:105288038-105288060 CAACAAAGGTGGTGCCGGGACGG + Intronic
1126929793 15:53634806-53634828 CAACCAAGGTGGTGCCAGTAGGG + Intronic
1130048992 15:80467777-80467799 CAACCAAGGTGCAGCAAGAAAGG - Intronic
1135161161 16:20097662-20097684 CAACTAAGGTCGTGCAACTAAGG - Intergenic
1135510665 16:23080357-23080379 CAGCTAAGGTGGAACCAGTAAGG + Intronic
1139671085 16:68492884-68492906 CAACCCAGGTGGAGCCAGTGGGG + Intergenic
1140244227 16:73233595-73233617 CAGCCATGGGGGTGCCAGTTTGG + Intergenic
1141036554 16:80631124-80631146 TAACCAAGTAGGTGCCAGGAGGG - Intronic
1141838980 16:86562168-86562190 CAACCAAGGTGGGGTCAGAGGGG - Intergenic
1142879258 17:2871597-2871619 CAGCCACGGGGGTGCCAGCACGG + Intronic
1143597911 17:7926383-7926405 CAACTATGGTGGAGCCAGGAAGG + Intronic
1143625246 17:8106167-8106189 CAACTAGGGTGGTGACAGTAGGG + Intronic
1143754270 17:9055006-9055028 CAACCAAGGAGCTGCCAAGAGGG - Intronic
1146756467 17:35435966-35435988 CGACCAAGGTGGTTCAAGTCAGG - Exonic
1152938515 17:83153934-83153956 CAGCCACGGTGGTGACAGCAAGG - Intergenic
1155037826 18:22040065-22040087 GAACCAAAGGGGTGCCAGGAGGG - Intergenic
1157617973 18:48998571-48998593 CACCCTAGGTGGTTCCAGCATGG - Intergenic
1161079966 19:2305752-2305774 CAACCAGGGCGGTGGGAGTAAGG + Intronic
1161577830 19:5064660-5064682 CAAGCAAGATGGTGCCAGGCAGG + Intronic
1164467528 19:28500578-28500600 GAACCAAGGGGGTGCAAGTGGGG - Intergenic
1165918680 19:39278025-39278047 CTGCCAAGGTGGTGCCAATGAGG - Intergenic
926699412 2:15793281-15793303 CCACCATGCTGGTGCCAGGAGGG + Intergenic
928482128 2:31693546-31693568 CAATGAAGGTGTTGCCACTAGGG - Intergenic
932413039 2:71558487-71558509 CACCCAAGGTGGTGCCAACATGG - Intronic
932884907 2:75540896-75540918 CAACCAAGGTAGGGACAGAAGGG + Intronic
935063036 2:99624270-99624292 TAACCAAGGAGGTGACAGTTTGG + Intronic
935625756 2:105171138-105171160 CAACCAAGGTGGTGGCTCCATGG + Intergenic
937108888 2:119346894-119346916 CAAGCAAGGTGTTGCCAATGGGG + Intronic
940707717 2:157125624-157125646 CAAGCAAGGTGGAGTCAGTTAGG - Intergenic
1169008861 20:2232959-2232981 GAACCAAGGAAGTGGCAGTAGGG - Intergenic
1169854157 20:10085264-10085286 CAGCCAAGGTGCAGCCAGGAGGG + Intergenic
1178493256 21:33067699-33067721 CAGCCTAGGTGGGGCCCGTAGGG - Intergenic
1179273129 21:39866750-39866772 CAACCACAGTGGGGCCAGGAAGG - Intergenic
1181400433 22:22647495-22647517 CAGCCCAGGTGGTGCCATTTCGG - Intronic
1181648933 22:24248296-24248318 CAGCCCAGGTGGTGCCATTTCGG + Intergenic
1181702413 22:24628593-24628615 CAGCCCAGGTGGTGCCATTTCGG - Intronic
1183937567 22:41272112-41272134 CAAACAAGGTGGTGCTGTTAGGG + Intronic
955630475 3:60968091-60968113 GATCCAAGGTGTTGCCAGAATGG + Intronic
958732842 3:97977144-97977166 CAACTAAGGTGGTACTAGTCAGG + Intergenic
969100925 4:4767803-4767825 CAACCAAGGTGCTGGGATTACGG - Intergenic
969157131 4:5220816-5220838 CAACTAAGGTGGTGGCAGTGGGG + Intronic
970314718 4:14818134-14818156 CTTCCCAGGTGGTTCCAGTATGG + Intergenic
978343068 4:107738020-107738042 CCACCACGGTGGTGCTAGAAAGG - Intergenic
980777239 4:137452877-137452899 GAACCAAGATGGAGTCAGTAAGG + Intergenic
990892935 5:60666914-60666936 CAATAAAGGTGGTGTCAGTTGGG - Intronic
995005106 5:107182918-107182940 CGACTATGGTGGTGACAGTAGGG + Intergenic
996637741 5:125714894-125714916 CAACCAAGCTGCTGCCAGATGGG + Intergenic
998005156 5:138651803-138651825 GAACCAAGGTGGTGGCTGTGTGG - Intronic
999307596 5:150530182-150530204 CAACTAAGGTGGAGCCTGGAGGG - Intronic
1002426927 5:179182023-179182045 CAACAAAGGAGGTGACAGGAAGG - Intronic
1005897571 6:30191067-30191089 GAACTAAGGTGGTGGCAGTAGGG + Intronic
1006569811 6:34993060-34993082 CAAACAAGGGGGTGGGAGTAGGG - Intronic
1011207555 6:84916138-84916160 CAAGCAACGTGGTGCCTATAGGG + Intergenic
1015464456 6:133533249-133533271 CAAACACGGAGGTGCCAGTTTGG - Intergenic
1015958286 6:138621060-138621082 CAAGCATGGTGGTGCCACTGGGG - Intronic
1019338304 7:495340-495362 AAACCAAGGAGGTCCCAGGAGGG + Intergenic
1020717010 7:11687164-11687186 GAACCAAGGTGAGGCAAGTAAGG - Intronic
1020934636 7:14447098-14447120 TAACCAAGGTGGAGTCACTATGG + Intronic
1029912804 7:104173215-104173237 CAACAAAGGTGGTACCAGTTCGG - Intronic
1030301494 7:107978975-107978997 CCACCAAGGTGGGTCCAGGAGGG - Intronic
1030573866 7:111262039-111262061 CAGCCAAGGTAGTGGTAGTAGGG + Intronic
1035238818 7:157517176-157517198 CACCCAGGGTGCTGCCAGTCTGG + Intergenic
1037645226 8:20787072-20787094 CAACCAAGGTGGGGAAAGGAGGG - Intergenic
1039431258 8:37526881-37526903 CAAACAAGGCGGTGACAGCAAGG + Intergenic
1040057675 8:43074602-43074624 CATCCAAGTTGTTGCCGGTATGG - Intronic
1041886884 8:62820035-62820057 GAACCAAGGTGGGGACAGTGAGG + Intronic
1045316611 8:101048980-101049002 GAACCGAGGAGGTGGCAGTAAGG - Intergenic
1047472347 8:125188963-125188985 AAACCAAGGTAGTGCCAATAGGG + Intronic
1050968190 9:11835214-11835236 CAACCAAGATGGAGTCACTATGG + Intergenic
1052005568 9:23343968-23343990 GAACCAAGGTAGTGGCAGTGAGG + Intergenic
1057182243 9:93036447-93036469 CACTCAAGATGGTGCCAGTGGGG + Intergenic
1058235062 9:102479663-102479685 CATCCAATCTGCTGCCAGTATGG - Intergenic
1186720666 X:12300348-12300370 CAACCAGGGGAGGGCCAGTAAGG + Intronic
1188504288 X:30864641-30864663 TAAACAGGGTGGTGCCATTATGG + Intronic
1193738093 X:85185088-85185110 CCAACAAGGTGGTACCACTATGG - Intergenic
1194347548 X:92784964-92784986 CTACTAGGGTGGTGCCACTAAGG - Intergenic
1194466435 X:94239875-94239897 CCACCAAGGTGGTACCTCTATGG - Intergenic
1197384534 X:125786960-125786982 CAACCAAGGAGGTCTCAGTAGGG - Intergenic
1200655870 Y:5901597-5901619 CTACTAGGGTGGTGCCACTAAGG - Intergenic