ID: 1126932426

View in Genome Browser
Species Human (GRCh38)
Location 15:53669368-53669390
Sequence ACTTAGCCCTAGGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126932418_1126932426 -2 Left 1126932418 15:53669347-53669369 CCCTCTCTAGCAAGGTCAGGAAC 0: 1
1: 0
2: 2
3: 15
4: 145
Right 1126932426 15:53669368-53669390 ACTTAGCCCTAGGGGGTGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 111
1126932419_1126932426 -3 Left 1126932419 15:53669348-53669370 CCTCTCTAGCAAGGTCAGGAACT 0: 1
1: 1
2: 3
3: 31
4: 198
Right 1126932426 15:53669368-53669390 ACTTAGCCCTAGGGGGTGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 111
1126932414_1126932426 20 Left 1126932414 15:53669325-53669347 CCATTCAGTACATATAACCATAC 0: 1
1: 0
2: 1
3: 12
4: 99
Right 1126932426 15:53669368-53669390 ACTTAGCCCTAGGGGGTGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 111
1126932416_1126932426 3 Left 1126932416 15:53669342-53669364 CCATACCCTCTCTAGCAAGGTCA 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1126932426 15:53669368-53669390 ACTTAGCCCTAGGGGGTGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126932426 Original CRISPR ACTTAGCCCTAGGGGGTGGA GGG Intronic
900563918 1:3323171-3323193 ACTTAGCCCTTGGGAATGGCAGG + Intronic
900954970 1:5881114-5881136 CCTCAGCCCTAGGGGAGGGAGGG + Intronic
901032414 1:6314961-6314983 AGTGAGCCCGAGGGTGTGGAGGG - Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
902649564 1:17827733-17827755 TGTAAGCCCTAGGGGATGGATGG + Intergenic
902748715 1:18491309-18491331 ACTTAACCCCAGGGTGTGGGTGG - Intergenic
903913755 1:26748142-26748164 GCTTAGAACTAGGGGCTGGATGG - Intronic
905370505 1:37480226-37480248 GCTCAGGCCTAGGGGGTGGCAGG + Intronic
906173454 1:43747727-43747749 ACTTAGCCAGAGGTGGTGGTGGG - Intronic
910439743 1:87240227-87240249 AATTAGCCATGGTGGGTGGATGG - Intergenic
910763885 1:90761669-90761691 GCTTTGGCGTAGGGGGTGGAAGG + Intergenic
912064703 1:105722660-105722682 ACTTGAACCTAGGAGGTGGAGGG + Intergenic
912920973 1:113866828-113866850 ACTTGACCCCAGGGGGTGGAGGG - Intronic
913323978 1:117610332-117610354 ACTCTGCCATGGGGGGTGGAGGG - Intronic
915930509 1:160057891-160057913 GCTTGGACCTAGGGGGTGGAGGG + Intronic
919105154 1:193140393-193140415 ACATATCCCCAGAGGGTGGATGG - Intronic
919797613 1:201330853-201330875 ACACAGCCCAAGAGGGTGGAAGG - Exonic
921312578 1:213858842-213858864 ACTTTGCCCTTGGGATTGGATGG - Intergenic
1069733721 10:70637300-70637322 CCTGAGCCCTAGGAGGTTGAGGG + Intergenic
1070499070 10:77053424-77053446 ATCTAGCCTTAGGGAGTGGAGGG + Intronic
1071236020 10:83649593-83649615 AATCAGCCATAGAGGGTGGATGG - Intergenic
1075448292 10:122529162-122529184 AGTCAGCCCTTGGGAGTGGATGG - Intergenic
1075794170 10:125107042-125107064 ATTTATCCTTGGGGGGTGGAGGG + Intronic
1077327553 11:1970313-1970335 ACTTTGAACTTGGGGGTGGAGGG + Intronic
1077497106 11:2891669-2891691 ACTGGGCCCTCGGGGGTGAAGGG + Intronic
1078408234 11:11089813-11089835 AATTAGCTCCAAGGGGTGGATGG + Intergenic
1080865349 11:36189540-36189562 ACGTAGGCCTAGGGTGTAGATGG - Intronic
1083050365 11:59771293-59771315 ACTTAGGCCCAGGAGGTTGAAGG + Intronic
1083405887 11:62456782-62456804 ACTCAGCCGTAGGCGGTGGCAGG - Intronic
1083764822 11:64836697-64836719 ACTCAGCCCTGGGGGGGGGGGGG + Intronic
1083862839 11:65433877-65433899 ACCTTGGCCTAGGGGGTGGCAGG - Intergenic
1084106305 11:66983023-66983045 ACTTAGACATCGGGTGTGGAGGG + Intergenic
1084757504 11:71249113-71249135 ACTTAGCCCTGGGGGGCTGCAGG + Intronic
1084964682 11:72738495-72738517 ACCTAGCCCTATGGGGAGCAAGG + Intronic
1085165263 11:74394008-74394030 ACTTAGCCCTAGAGCATAGAAGG + Intronic
1087548428 11:99614547-99614569 TCTTAGCCTTAGGGGTTGGGAGG + Intronic
1087945827 11:104159002-104159024 AATTAGCCCGAGGCGGTGGTAGG + Intronic
1088108174 11:106228849-106228871 ACTTTTACCTAGGGTGTGGATGG - Intergenic
1089298811 11:117485527-117485549 AGTTAGCTTTAAGGGGTGGAAGG - Intronic
1089637641 11:119826385-119826407 ACTTGGGACTATGGGGTGGAAGG - Intergenic
1202810535 11_KI270721v1_random:25493-25515 ACTTTGAACTTGGGGGTGGAGGG + Intergenic
1091991869 12:4962009-4962031 TCTTAGCCATTGGGGGAGGAAGG + Intergenic
1096173461 12:49493482-49493504 ACTTAAACCTGGGAGGTGGAGGG - Intronic
1096401834 12:51313694-51313716 CCTTAACCCTAGGGGGAGGGTGG + Intronic
1100607788 12:96165980-96166002 TCTGAGCCCTGGGGGGTGGGAGG - Intergenic
1110000364 13:70190551-70190573 ATTTAGTGCTAGGGGATGGAGGG + Intergenic
1126932426 15:53669368-53669390 ACTTAGCCCTAGGGGGTGGAGGG + Intronic
1129941034 15:79496725-79496747 ACTTAGCCCTGGGGGTTGGTGGG + Intergenic
1131257918 15:90873648-90873670 CCCCAGCCCTAGGGGATGGAAGG - Intronic
1132490933 16:230506-230528 AATTAGCCGGAGGGGGTGGCGGG - Intergenic
1139837631 16:69852357-69852379 ACTTGAACCTAGGAGGTGGAGGG - Intronic
1140265643 16:73418221-73418243 AATAAGCCCCAGGGCGTGGAAGG + Intergenic
1148451601 17:47781561-47781583 ACCTCACCCTAGGGGTTGGAAGG - Intergenic
1148599756 17:48885283-48885305 CCTTAGCCCCAGGGTATGGATGG - Intergenic
1151247154 17:72803761-72803783 AATTAGGCCTAGGGGATGAAGGG - Intronic
1151491393 17:74433817-74433839 CCTTGGCCCTGGTGGGTGGAGGG + Intronic
1153839007 18:8989738-8989760 ACTTGAACCTAGGAGGTGGAGGG - Intergenic
1155394095 18:25368014-25368036 ACTTAACCTTGGGGGGTGGTTGG + Intergenic
1164364016 19:27553428-27553450 ACTGAGCCCTAGGGTGAAGAAGG + Intergenic
1164539807 19:29114161-29114183 AGTTCGCTCTAGGGGGTGGTGGG + Intergenic
1164595969 19:29530769-29530791 ACTTTGTCCAAGGGTGTGGAGGG + Intronic
1166197374 19:41216027-41216049 ACTGAGCCCTAGGGTGGGCAGGG + Intergenic
1166845569 19:45725952-45725974 ACTTGGGCCCAGGAGGTGGAAGG - Intronic
1167140906 19:47650213-47650235 ACTTGACCCTGGGTGGTGGAGGG - Intronic
1167703853 19:51066576-51066598 AGTTAATCCTAGGGGGTGGAGGG + Intergenic
926919953 2:17930486-17930508 ACCAAGCCCTAGGGATTGGAAGG + Intronic
928095140 2:28399969-28399991 ACTCTGCTCTAGGAGGTGGATGG + Intronic
930884880 2:56314145-56314167 ACTTAGCCATAGTGGGAGGGTGG + Intronic
930914659 2:56672306-56672328 GCTTAGCCCCAGGGGGTTGGAGG + Intergenic
936710536 2:115125718-115125740 AATTAGCCCTGTGTGGTGGAGGG - Intronic
942042915 2:172082784-172082806 CCTTAGCAGTAGGGGGTGGGAGG + Intergenic
943576033 2:189632310-189632332 ACTTGGGCCTAGGAGGTGGAGGG - Intergenic
944137216 2:196412868-196412890 ACATAGCCCTAAAGGCTGGAAGG + Intronic
1172983909 20:38967114-38967136 ACTTAGCTCTAGGGGGTCTACGG + Intronic
1173447116 20:43129154-43129176 ACTCTGCCCAAGGGGGTGTAGGG + Intronic
1173752575 20:45488543-45488565 TCTAAGCCATAGGGGGTGGCTGG - Intergenic
1179141799 21:38732446-38732468 ACTTTGCACTTGGGGGTTGAAGG - Intergenic
1179625239 21:42645520-42645542 TTTTAGCCCAAGGGGGTGGGGGG + Intergenic
1185241037 22:49747635-49747657 AACAAGCCCTAGGGGGTGGGGGG - Intergenic
954416281 3:50394984-50395006 ACTTAGGCCCAGAGGGTGGCCGG - Intronic
954436122 3:50497269-50497291 ACTGAGGCCCAGGGGGAGGAGGG + Intronic
955423765 3:58766421-58766443 GCTTAGACCTTGGTGGTGGAAGG - Intronic
961070185 3:123916988-123917010 AATTAGCCCTGCGTGGTGGAGGG - Intronic
961369165 3:126419061-126419083 TCTCAGCCCTAGGGGTTGGGCGG - Exonic
961603294 3:128076635-128076657 ACTTAGGCCTGAGGGGTGGGGGG - Intronic
962119757 3:132549267-132549289 ACTTTGCCCTTGCCGGTGGAGGG + Intergenic
977150242 4:93502587-93502609 ACTTAGCAGTAGAGTGTGGAGGG - Intronic
985031095 4:185791368-185791390 ACATAGACCTTGGGTGTGGAAGG + Intronic
990815522 5:59780839-59780861 ACTGAGCCCTAGAGAGTGGTTGG - Intronic
991411951 5:66354481-66354503 ACTGAATCCTATGGGGTGGAGGG - Intergenic
993971849 5:94429657-94429679 ACTCAGCCCTGGGGGGTGGCAGG + Intronic
999391799 5:151198835-151198857 CCTTGGCCCTAGAGGGTTGATGG - Intronic
1000223529 5:159236500-159236522 GCTTAGACCCAGGAGGTGGAGGG - Intergenic
1001422942 5:171600824-171600846 ACTGAGGCTTAGGGGGTGGAGGG - Intergenic
1001646062 5:173283263-173283285 CCTTAGCCCTGGGGGCAGGAGGG - Intergenic
1003118680 6:3301642-3301664 ACGTGGCCCTAGGGGTTGGAAGG - Intronic
1008804344 6:55409597-55409619 AATTAGCCCTACAGGGTGGCGGG - Intergenic
1014205150 6:118649605-118649627 CATTATCCCTAGGGGCTGGAGGG - Intronic
1018667374 6:166150989-166151011 AATTAGCCCTATGTGGTGGCGGG - Intergenic
1020102242 7:5400527-5400549 ACTTGAACCTAGGAGGTGGAAGG + Intronic
1026264452 7:68784010-68784032 ACTTACCCCTGAGGGGTGGAGGG + Intergenic
1026413068 7:70146756-70146778 ACTAAGCCCTAGGAAGTGGAAGG - Intronic
1027051784 7:75025390-75025412 ACTCAGTCCTTGGGGGAGGAGGG + Intergenic
1029378824 7:100199398-100199420 GTTTCACCCTAGGGGGTGGAAGG - Intronic
1034274961 7:149819972-149819994 ACTGAGCCCTCTGGGGTGGAGGG + Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035062290 7:156078606-156078628 AGTGAGCCCTAGGGTGGGGAGGG - Intergenic
1041513127 8:58672866-58672888 ACTTAGCTCAAGGGGGTGAGAGG - Intergenic
1043684106 8:83066410-83066432 ACTTTGCCCTTGGGAGAGGAAGG - Intergenic
1044308482 8:90665722-90665744 GCTCAGCCCTGGGTGGTGGAGGG + Intronic
1047715425 8:127590778-127590800 GCTGAGCCGTAGGGAGTGGAGGG - Intergenic
1048270137 8:133021859-133021881 ACTTAGCCCCATGCAGTGGATGG - Intronic
1049948503 9:621841-621863 ACTTTGCCCTCGCCGGTGGAAGG + Intronic
1051966540 9:22835647-22835669 ACCTAGAGCTAGGGGGTGCAAGG + Intergenic
1055529293 9:77167920-77167942 AATTAGCCATACGGGGTGGCGGG - Intergenic
1056262508 9:84862896-84862918 ACTTGGCCCTGGGGTGGGGAGGG + Intronic
1057928217 9:99171182-99171204 GCTGAGCCCCAGGGGGAGGAAGG - Intergenic
1062469024 9:136694292-136694314 ACTTGGCCCTAGGCTGGGGAAGG - Intergenic
1062483822 9:136764500-136764522 ACTCAGCACCAGGGGCTGGAGGG - Exonic
1186316648 X:8378026-8378048 CCTTAGCCCTAGAGAGTGAAGGG + Intergenic
1188565582 X:31522777-31522799 ACTTAGTGATAGGGTGTGGAAGG + Intronic
1191135623 X:57060960-57060982 AACTAGCTCTTGGGGGTGGAAGG + Intergenic
1192236359 X:69298676-69298698 ACTAAGGCCCAGGGGGAGGAAGG + Intergenic
1199964764 X:152810710-152810732 TCTGACCCCTAGGGGATGGATGG + Intergenic