ID: 1126932881

View in Genome Browser
Species Human (GRCh38)
Location 15:53674539-53674561
Sequence GCTAACTAGAAAATAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126932877_1126932881 10 Left 1126932877 15:53674506-53674528 CCACAAACAGGGGCCCTGGAGGT 0: 1
1: 0
2: 2
3: 11
4: 171
Right 1126932881 15:53674539-53674561 GCTAACTAGAAAATAATGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 178
1126932873_1126932881 14 Left 1126932873 15:53674502-53674524 CCCACCACAAACAGGGGCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 198
Right 1126932881 15:53674539-53674561 GCTAACTAGAAAATAATGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 178
1126932878_1126932881 -3 Left 1126932878 15:53674519-53674541 CCCTGGAGGTATCAAATTTAGCT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1126932881 15:53674539-53674561 GCTAACTAGAAAATAATGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 178
1126932875_1126932881 13 Left 1126932875 15:53674503-53674525 CCACCACAAACAGGGGCCCTGGA 0: 1
1: 0
2: 0
3: 26
4: 234
Right 1126932881 15:53674539-53674561 GCTAACTAGAAAATAATGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 178
1126932879_1126932881 -4 Left 1126932879 15:53674520-53674542 CCTGGAGGTATCAAATTTAGCTA 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1126932881 15:53674539-53674561 GCTAACTAGAAAATAATGGAAGG 0: 1
1: 0
2: 1
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126932881 Original CRISPR GCTAACTAGAAAATAATGGA AGG Intronic
909272218 1:73637763-73637785 GCTAAGAAGAAAATAATGCATGG - Intergenic
909457257 1:75864000-75864022 GACAGGTAGAAAATAATGGATGG - Intronic
909592926 1:77371785-77371807 GCAGACTAAAGAATAATGGAGGG + Intronic
912645398 1:111387237-111387259 ATTAACTAGACAATACTGGAAGG + Intergenic
914515739 1:148372556-148372578 GCTTATTAGGAAAGAATGGAAGG - Intergenic
915374304 1:155379219-155379241 ACTGACTAGAAAATAATGGTGGG - Intronic
915928071 1:160039562-160039584 GCCAACTAGAAGGTAATGGTGGG + Exonic
916049397 1:161025021-161025043 GTAAAGTAGAAAATTATGGAAGG + Intronic
916424428 1:164667263-164667285 GCTAAGTAAAAAACAATGCAAGG + Intronic
916995162 1:170288851-170288873 GCTTATTAGAAAATAATTTAAGG + Intergenic
917627506 1:176861259-176861281 GTTAACTAAAAAATAATGAACGG + Exonic
918120501 1:181535067-181535089 GATAAAAAGAAAATAATTGAAGG + Intronic
918459122 1:184757263-184757285 GCTAACTAGAAGGTTCTGGAAGG - Intergenic
918869463 1:189950135-189950157 GCTAAGAAGAAAATCATGAAGGG + Intergenic
918901310 1:190423042-190423064 TCTCAGTAGAAAATAAGGGAGGG + Intronic
920012551 1:202879720-202879742 AGCAACTAGAAAACAATGGAAGG + Exonic
920782705 1:209010073-209010095 GAAAACTGGAAAATGATGGATGG - Intergenic
923158265 1:231296999-231297021 GAAATCTAGAGAATAATGGAAGG - Intergenic
924056999 1:240133683-240133705 GCTAACTGGGAAATAATAGTGGG - Intronic
1063205212 10:3824802-3824824 TCTAAATATAAAAAAATGGATGG - Intergenic
1064858691 10:19800539-19800561 GTTAACTACAAAAAAAAGGATGG - Intergenic
1065944418 10:30593891-30593913 GCTATCTAGGAAAAAAAGGAAGG - Intergenic
1067997992 10:51297840-51297862 ACTAAAGAGAAAATAATGGGAGG - Intronic
1068779042 10:60899836-60899858 GCCAATTAGAAAATAAAGCAGGG + Intronic
1069100633 10:64316371-64316393 GTTAACTAGAAATAACTGGAGGG - Intergenic
1069525423 10:69166074-69166096 GCCAAATATGAAATAATGGATGG + Exonic
1070481132 10:76883843-76883865 GTCAAATAGAAAACAATGGAGGG + Intronic
1071026081 10:81115019-81115041 ACTAACTTGAAATTAAGGGAAGG - Intergenic
1071288199 10:84168320-84168342 GGTGATTAGAAAATAATGAATGG - Intergenic
1072307171 10:94118899-94118921 GGGAACTACAAAAAAATGGACGG - Intronic
1073364593 10:102928281-102928303 GGTAACTTAAAAATAATAGAAGG + Intronic
1074710746 10:116175539-116175561 GCTAGCGAGAAAATTCTGGATGG - Intronic
1075011367 10:118873164-118873186 AATAACTAGAAAATAACTGATGG + Intergenic
1075685705 10:124363956-124363978 GCGGACGAGAGAATAATGGAAGG - Intergenic
1085130012 11:74030138-74030160 GGTAACTAGAAGACAATGCAAGG - Intronic
1086128398 11:83374101-83374123 AATAAATAGAAAATAATGGAAGG - Intergenic
1086380514 11:86247564-86247586 GTTACCTAGATAATAATAGAAGG + Intronic
1086578105 11:88363513-88363535 GCTAAGAAGAAAATTAGGGATGG + Intergenic
1087881665 11:103423060-103423082 GAAAACGAGAAAAAAATGGAAGG + Intronic
1090154510 11:124423644-124423666 CCTACCAAGAAAAGAATGGAAGG + Intergenic
1090175606 11:124646479-124646501 GTTAACTAGGAAAGTATGGAAGG + Intronic
1096065808 12:48739230-48739252 GCTAACTAGAAGCTGATGGAGGG + Intergenic
1099167020 12:79319408-79319430 GCCAAGTAGCTAATAATGGAAGG + Intronic
1100025661 12:90124791-90124813 TTTAACTAGACAATAAGGGAAGG + Intergenic
1100588616 12:96002653-96002675 GGTAACTAGAAGATAATTGGTGG - Intronic
1101622862 12:106406942-106406964 GCTGACTGTAAAATAATGGAAGG + Intronic
1107182755 13:37480954-37480976 GCTAAATAGAAAATAACAAAAGG + Intergenic
1108856695 13:54801258-54801280 GTTTATTAGAAAATAAAGGAGGG - Intergenic
1110047523 13:70849139-70849161 GGTAAAAAGAAAATAAGGGAAGG + Intergenic
1111456199 13:88487341-88487363 GCAAACTAGGAAACAATGGCTGG - Intergenic
1112206995 13:97334331-97334353 CTCAACTAGAAATTAATGGAAGG + Exonic
1112577360 13:100647343-100647365 GTCAACTTGAAAACAATGGATGG - Intronic
1112916510 13:104556836-104556858 GCAATATAGAAAATAAAGGAAGG - Intergenic
1116030507 14:39565476-39565498 ACAATCAAGAAAATAATGGAAGG - Intergenic
1116160414 14:41260550-41260572 GCTCAATAGAAAATAATAGTGGG + Intergenic
1117837556 14:59823115-59823137 GATAACTACACAATAATGGTGGG - Intronic
1123755554 15:23395117-23395139 GCTAACTAGGAAAAAATGGAGGG + Intergenic
1126373948 15:47975604-47975626 GCCAAATACAAAAGAATGGAGGG - Intergenic
1126453364 15:48834605-48834627 GCTAACTAGAGGGTAGTGGAGGG - Intronic
1126932881 15:53674539-53674561 GCTAACTAGAAAATAATGGAAGG + Intronic
1127569281 15:60225361-60225383 GCTAACTAAAAAATATTCTATGG + Intergenic
1129509093 15:76107092-76107114 GCTAACTAGAAAATTTTAAATGG - Intronic
1130019606 15:80216915-80216937 TCAAACTCTAAAATAATGGAAGG - Intergenic
1135697388 16:24602047-24602069 GAAAAATAGAAAACAATGGAGGG - Intergenic
1137941942 16:52696492-52696514 GCTAAAAAGAAAATCAAGGATGG - Intergenic
1143999136 17:11036395-11036417 GCTAAATAGAAAATGCTGCATGG - Intergenic
1145334270 17:21899156-21899178 GCGGACTTGAATATAATGGATGG + Intergenic
1145957240 17:28862899-28862921 GCTAACTAGACAAGAAAGGAGGG - Intergenic
1147743343 17:42680939-42680961 GCAATATGGAAAATAATGGATGG + Intronic
1148953615 17:51335691-51335713 GCTGACTAGGAAAAAATGGATGG + Intergenic
1153049950 18:892856-892878 GTTTAATAAAAAATAATGGAAGG + Intergenic
1154049076 18:10936216-10936238 GCTGACTAGAAAGTAAGGCAAGG - Intronic
1155981380 18:32183979-32184001 GCTATCAAGAAAAAAATGCAAGG - Intronic
1156901436 18:42304939-42304961 CCTCACTAGAACATCATGGAGGG + Intergenic
1157139886 18:45095103-45095125 GCAAAAGAGAAAATAATTGATGG - Intergenic
1159169258 18:64742630-64742652 TATATCTAGAAAGTAATGGATGG - Intergenic
1159575828 18:70175825-70175847 GCTAACTATAAAATAATTTCTGG + Intronic
1160474793 18:79172728-79172750 GCTAACTAGGATTTCATGGATGG + Intronic
1163887492 19:19979607-19979629 AGTAACTGGAAAATAATGAATGG - Intergenic
1165219943 19:34307251-34307273 GCTCACTACAAAAGAATGGCAGG - Intronic
1167323940 19:48812735-48812757 GCTAATTAGGAGGTAATGGAGGG - Intergenic
1167691669 19:50988458-50988480 GGTAACTAGAAGAAAATGGGAGG + Intergenic
1167885376 19:52495558-52495580 GCTATGTATAAAATGATGGAGGG + Intronic
925145094 2:1576443-1576465 GGCAAATAGAAAATAATAGATGG + Intergenic
927139660 2:20121068-20121090 ACTGTCTAGAAAATAATAGAAGG - Intergenic
932505002 2:72220361-72220383 GGCAACTAGAAAATACAGGAAGG + Intronic
937508542 2:122565610-122565632 GCCAGGTAGAGAATAATGGAAGG + Intergenic
937969833 2:127540978-127541000 GCTAGCTCTAAAATGATGGAGGG + Intronic
939711298 2:145523341-145523363 GCTGACGAGAAATCAATGGATGG - Intergenic
940538970 2:154986012-154986034 GATAATTAGAAAAGAATGGAAGG - Intergenic
940788781 2:158010354-158010376 CCTCACTAGAAAATAAGGAAAGG - Intronic
945193528 2:207215631-207215653 GCTGACTAGAAAGTAATGGTTGG + Intergenic
945549341 2:211200207-211200229 GCCAACAAGAAAATGAGGGATGG - Intergenic
947300542 2:228683978-228684000 GCTAACTGGAAACTCATGGCTGG + Intergenic
1169479377 20:5964219-5964241 CCTAAATATAAAATAATGAATGG + Intronic
1173629390 20:44499415-44499437 GCTATCCAGAAAATAAAGAATGG + Exonic
1174544659 20:51316416-51316438 GCTAGGTAGAAAAGAAAGGAAGG + Intergenic
1174924791 20:54747295-54747317 GCAAGCTAGAAAACAATGGCTGG + Intergenic
1174942887 20:54950806-54950828 GCTCACTATAAAATATTGTAAGG - Intergenic
1177479163 21:21663744-21663766 GATAATTAGAAAATAGAGGAGGG + Intergenic
1178166985 21:29990570-29990592 GCAAACTTGAAAGTAATTGAGGG - Intergenic
1182434449 22:30321396-30321418 ACTAACTAGAGAATAAGGCAAGG + Intronic
1182959913 22:34462590-34462612 TCTAATTAGTAAATAATGTAGGG - Intergenic
951753519 3:26063267-26063289 GCAAACAAGAAAATAAGAGAAGG - Intergenic
954999125 3:54910589-54910611 CCTAACTAGTAAATGTTGGAGGG + Intronic
956540324 3:70330505-70330527 CATTACCAGAAAATAATGGAAGG + Intergenic
956925886 3:73987988-73988010 GTTAAAAAGAAAATAATGCAAGG - Intergenic
957861124 3:85951866-85951888 ATTAACTAGATAATAATGGATGG + Intronic
959073973 3:101731087-101731109 GGTAACTAAAAAATAAAGGGAGG - Intronic
959517378 3:107284245-107284267 CGTAACTAGATGATAATGGATGG + Intergenic
960009537 3:112818527-112818549 GCTAGCAAGCAAGTAATGGATGG + Intronic
960784758 3:121360135-121360157 GATCACTATAAAATAATGAAGGG - Intronic
960852826 3:122073998-122074020 GGTAACTGGAAAATGATGGAAGG + Intronic
962366130 3:134784499-134784521 ACTTAAGAGAAAATAATGGAAGG - Intronic
963286336 3:143437928-143437950 GGTCACTAGAAAATTATAGAGGG + Intronic
963441109 3:145341845-145341867 GTTAACGAGAAAATCAGGGAAGG - Intergenic
966874002 3:184311139-184311161 GCTAACTTGAAGATTATGGCAGG - Intronic
975185986 4:71403474-71403496 GCTATCTTGAAAATAAAGCAGGG + Intronic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
976527000 4:86104274-86104296 GTATACTAGAAAATATTGGATGG - Intronic
976668864 4:87629545-87629567 GCTAAGAAAAAAATAATGTAGGG + Intergenic
977190784 4:93998313-93998335 GCCCACTTGAAAATAATGAAAGG - Intergenic
977285354 4:95099014-95099036 GATAACTTTAAAATAATTGATGG - Intronic
977730691 4:100347870-100347892 GGAAACTAGAAAATAAAGGAAGG - Intergenic
977780463 4:100975642-100975664 GGAAAATGGAAAATAATGGAAGG - Intergenic
978014704 4:103728508-103728530 AATATCTAGAAAATAGTGGAAGG + Intergenic
978378215 4:108097864-108097886 GGTCAGTGGAAAATAATGGAAGG + Intronic
978884280 4:113747647-113747669 ACTAAGTAGAAAATAAAGGACGG - Intronic
979769961 4:124511226-124511248 GATAGCTAGAATAAAATGGATGG + Intergenic
979875584 4:125886844-125886866 GCTATTTAGATAATACTGGATGG + Intergenic
980097473 4:128506537-128506559 TCTAAATAGAAAACAAGGGACGG - Intergenic
980455312 4:133033084-133033106 GCTAGTTATAAAATAATGAAAGG + Intergenic
981382745 4:144091695-144091717 GATAAGTTGAAAGTAATGGATGG - Intergenic
985257022 4:188080545-188080567 GCTACAAAGAAAATAATGTAGGG + Intergenic
988045805 5:25951407-25951429 GCCACATAGAAGATAATGGAAGG - Intergenic
990002654 5:50912618-50912640 GCTAACTAAAAAATGAAAGACGG + Intergenic
991380574 5:66019359-66019381 GCTACCTAAAGAATACTGGAGGG + Intronic
993354674 5:86891298-86891320 GCTAATTAGAGGATAATGTAAGG - Intergenic
995079787 5:108036171-108036193 GCTACATTGAAAATAATAGATGG - Intronic
995969492 5:117950702-117950724 CCTAAATAGAGAAGAATGGAAGG + Intergenic
996649943 5:125863580-125863602 GCTACCTACAAAATAATGTTAGG - Intergenic
998733909 5:145112842-145112864 ACTATCTTGAAAATAAAGGAAGG + Intergenic
1000617813 5:163448918-163448940 GCTAACAACAAATTAATAGATGG + Exonic
1002602586 5:180362428-180362450 GCTTACTAGACAAGAATGCAAGG - Intergenic
1002873597 6:1190251-1190273 GATAATTAGAAAATAATGTTTGG - Intergenic
1009582177 6:65550055-65550077 GCTCAGTGAAAAATAATGGATGG - Intronic
1010131531 6:72499794-72499816 GATAACAAGAAAATAGGGGAGGG + Intergenic
1012531609 6:100244801-100244823 GCTGGCCAGAAAAAAATGGAGGG + Intergenic
1013785354 6:113773579-113773601 GTTAAATGGAAAATAATTGACGG - Intergenic
1014041565 6:116832914-116832936 AAAAATTAGAAAATAATGGAAGG - Intergenic
1014256153 6:119161605-119161627 GCTTTCTAGGAAATGATGGAAGG + Intergenic
1015270806 6:131336926-131336948 GCTAAAAAGAACATAATGGTAGG + Intergenic
1020387203 7:7619838-7619860 GGAAACTGGAAGATAATGGATGG - Intergenic
1021459024 7:20864716-20864738 GCTAGCTTGAATATGATGGAGGG - Intergenic
1023469696 7:40502021-40502043 ACTAAGAAGAAGATAATGGAGGG + Intronic
1026538309 7:71258872-71258894 GCTAAGTAGAAAGTAAGTGAAGG + Intronic
1028101108 7:86821860-86821882 ACTAATTAGAAAATTATGAAGGG - Intronic
1031700617 7:124920432-124920454 GCTAACTATAAAATTTTGGAAGG + Intronic
1033869949 7:145740175-145740197 GATAACTTTAAAATAATGAAAGG + Intergenic
1033944145 7:146694230-146694252 GCTAAATAGAAAATAATTTGGGG + Intronic
1036075781 8:5498026-5498048 GGAAACTAGGAAACAATGGATGG + Intergenic
1037242565 8:16793925-16793947 GCTAAGTACAAAATCATGTAAGG + Intergenic
1042392826 8:68255800-68255822 GCTAAATAGAAAAGGATGGAAGG + Intergenic
1042471296 8:69191459-69191481 GCCAACTAAAAAATAATTGAAGG + Intergenic
1042909876 8:73815549-73815571 GCTAAGAACAAAATAAAGGATGG + Intronic
1043314542 8:78903917-78903939 GACAACTAGATAAGAATGGAAGG - Intergenic
1044055223 8:87561353-87561375 CATACCTAGAAAAAAATGGACGG + Intronic
1044092942 8:88024824-88024846 GCAATCAAGAAAATAAGGGAGGG - Intergenic
1045442804 8:102231209-102231231 GCAAACTAGAAAATATTTGCTGG - Intronic
1046345514 8:112920794-112920816 GCTACTTAGAAAATAAAGAAAGG - Intronic
1047891336 8:129314591-129314613 GTTAACTAGGAAAAATTGGAAGG + Intergenic
1050615828 9:7400850-7400872 GCTATCTAGAAACAAAAGGAAGG - Intergenic
1052243506 9:26304724-26304746 ACTAACTACAAAAAAATTGACGG + Intergenic
1055122337 9:72676046-72676068 GGTAACAAGAAAAAATTGGATGG + Intronic
1056066226 9:82937954-82937976 GCCAACTATAAGCTAATGGAGGG - Intergenic
1056442805 9:86637532-86637554 TCTAACTAGGAAAAAATGGTGGG - Intergenic
1059015390 9:110510221-110510243 GCTAAGGAGAAACTCATGGAAGG - Intronic
1059127509 9:111705997-111706019 GGTGAATAGAAAATAATCGATGG + Intronic
1059250680 9:112885291-112885313 GCAGAGTAGAAAATAAAGGAAGG - Intronic
1185991833 X:4900066-4900088 CCTCACTAGAAAAGAAAGGAAGG + Intergenic
1188092815 X:25984365-25984387 TATAAGTAGAAAATAATGAATGG + Intergenic
1188209430 X:27404108-27404130 ACTTCCTAGAAATTAATGGAAGG + Intergenic
1190445461 X:50519580-50519602 GCAAACTGGAAAATTTTGGAGGG + Intergenic
1190599500 X:52075507-52075529 GATAACCACAAAATAATGGTGGG - Intergenic
1190609324 X:52178566-52178588 GATAACCACAAAATAATGGTGGG + Intergenic
1193223759 X:78957470-78957492 ACTAACAAGAAAATCCTGGATGG - Intronic
1193556262 X:82957787-82957809 ACAAACTAGAAATGAATGGAAGG + Intergenic
1194027150 X:88766641-88766663 CCAAACTAGAAATTAATAGAAGG + Intergenic
1194119236 X:89939382-89939404 GCAAGCTAGAATATTATGGATGG - Intergenic
1194411171 X:93560247-93560269 GCTAGCTTGAAAATAATGGGGGG + Intergenic
1194474351 X:94340062-94340084 GCTAACTAGATAATAATGTTAGG + Intergenic
1194541267 X:95175892-95175914 GCTAATTACAAAATGAGGGAAGG - Intergenic
1195005870 X:100685411-100685433 CTTAACTACAAAATAATGTAGGG - Intronic
1195118961 X:101730105-101730127 GGTCCATAGAAAATAATGGAAGG - Intergenic
1196586059 X:117429360-117429382 TGTAACAAGAAAATAATGGAAGG - Intergenic
1197996626 X:132383309-132383331 GGTAACTAGAGATAAATGGAAGG - Intronic
1198449524 X:136753126-136753148 ACTTACTAGAATATAGTGGATGG + Intronic
1200472109 Y:3596941-3596963 GCAAGCTAGAATATTATGGATGG - Intergenic
1201210711 Y:11677980-11678002 GCAGACTCGAATATAATGGATGG + Intergenic
1201455775 Y:14165633-14165655 GGTAACTAGAAGCTAGTGGAAGG - Intergenic