ID: 1126935815

View in Genome Browser
Species Human (GRCh38)
Location 15:53706587-53706609
Sequence CATCTTTAGCATCAAGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126935815_1126935817 -10 Left 1126935815 15:53706587-53706609 CCCATGTCTTGATGCTAAAGATG 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1126935817 15:53706600-53706622 GCTAAAGATGTCCACTGAGAAGG 0: 1
1: 0
2: 0
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126935815 Original CRISPR CATCTTTAGCATCAAGACAT GGG (reversed) Intronic
906414440 1:45609540-45609562 AATCATTAAGATCAAGACATGGG - Intronic
908410413 1:63859068-63859090 CATGCTGAGCATCATGACATGGG - Intronic
909064520 1:70918729-70918751 CAACTGTAGAATCAACACATTGG - Intronic
910061376 1:83097030-83097052 CATCCTTAGGATCACAACATAGG - Intergenic
910129645 1:83888212-83888234 CATATATAGCATCAAGCCAATGG + Intronic
913437467 1:118862170-118862192 CATCCTTAGTTCCAAGACATGGG + Intergenic
914424825 1:147566115-147566137 GACATTTAGCATCAAGACAGAGG + Intronic
919011996 1:191976455-191976477 CATGTTTAGCATCCAGATACTGG + Intergenic
920791112 1:209093842-209093864 CACCTTTAGAAGCAAGAGATAGG - Intergenic
920849041 1:209616187-209616209 CATCTTAAGCATAAAGCAATAGG + Intronic
923413327 1:233731207-233731229 TATTTTTGGCATCCAGACATAGG - Intergenic
924497564 1:244604912-244604934 CAGCTGTAGCATCAAGGCAGGGG + Intronic
1065680832 10:28230136-28230158 AATGTATAACATCAAGACATAGG + Intronic
1068420290 10:56782500-56782522 TATCCCTAGCATCAAGAAATAGG - Intergenic
1071724570 10:88184632-88184654 CATCTTTTGCATAAATAAATAGG + Intergenic
1071992095 10:91109476-91109498 CATCTTTTGCATCAGGACATTGG - Intergenic
1077899589 11:6478096-6478118 TGTCTCTAGCATCAACACATTGG - Exonic
1080216552 11:29849041-29849063 GATTTTTGGCATTAAGACATAGG - Intergenic
1086433609 11:86759646-86759668 CACCTATAGCATCATGACTTAGG + Intergenic
1087247849 11:95860736-95860758 CATTTTTACCATTAAGTCATAGG - Intronic
1089458190 11:118637714-118637736 CATCTTTAGGAACAAATCATGGG - Intronic
1091166165 11:133478174-133478196 CATCCTGAGCTTCGAGACATCGG + Intronic
1091697305 12:2636570-2636592 CACCTTTAGCATCAGCAAATTGG - Intronic
1093954766 12:25202971-25202993 CATTTTTAGCACCCAGACCTTGG + Intronic
1095338056 12:41052255-41052277 TATCTTTTGGATAAAGACATTGG + Intronic
1096028054 12:48385428-48385450 CATCTATAGCTTCAAGAAACAGG - Intergenic
1097718052 12:62988140-62988162 CATTTTTAGGATTAAGACACTGG - Intergenic
1098672221 12:73246378-73246400 CATCTTTAACATTTAGAGATTGG - Intergenic
1099540097 12:83896995-83897017 CATCTTTAGAATGAAAAGATAGG + Intergenic
1101698990 12:107153944-107153966 CATCCTTAGCATACAGTCATTGG - Intergenic
1101904629 12:108815385-108815407 CACGGTTAGGATCAAGACATTGG + Intronic
1102198656 12:111042340-111042362 CATCTGTAGCAGCAAGGCCTAGG - Intronic
1106315060 13:28586050-28586072 TATCTGTAGAATCCAGACATAGG - Intergenic
1109588190 13:64438156-64438178 CATCATTAGCATGAAGAGACTGG - Intergenic
1113442540 13:110340448-110340470 CATCTTTAGAATGAAGTCTTTGG - Intronic
1113538272 13:111085008-111085030 CATCACTGACATCAAGACATAGG + Intergenic
1114761957 14:25325809-25325831 CATCTGTAAAATTAAGACATTGG - Intergenic
1119888749 14:78166466-78166488 CATTTTTAGCCTCATTACATAGG - Intergenic
1120279763 14:82423975-82423997 CATCTATAGCATATAGATATTGG - Intergenic
1121893180 14:97617596-97617618 CATTTTTAGTATCTAGAAATAGG + Intergenic
1126935815 15:53706587-53706609 CATCTTTAGCATCAAGACATGGG - Intronic
1127334783 15:57973111-57973133 CATCATTAGCAGCAAGATAGTGG - Intronic
1127759356 15:62122584-62122606 CAACTTTAGCCTTAAGATATTGG + Intergenic
1128302382 15:66574634-66574656 CATCTTCAGCAGCCAGCCATGGG - Intergenic
1129025024 15:72563450-72563472 CAGGTTTAGCATCAGGATATTGG - Exonic
1130862111 15:87900338-87900360 CATCTTTAGCATCCTGGAATGGG + Intronic
1132456451 16:26326-26348 TATCTTTAGCATCCAGAGAGTGG - Intergenic
1133438774 16:5803068-5803090 CATCTTTAGCACCCAGACAATGG + Intergenic
1149462234 17:56839338-56839360 CAGCTTTAGCATCATGTCATTGG - Intronic
1149899497 17:60461029-60461051 TGTCTTGAGAATCAAGACATTGG + Intronic
1156210950 18:34941999-34942021 CAATTTTAGCATCAAAAAATTGG - Intergenic
1158352239 18:56574512-56574534 CATCTGTGGAATTAAGACATTGG + Intergenic
1158438669 18:57453840-57453862 CATCTTTGGAAACAAGACATAGG + Intronic
1158644052 18:59228525-59228547 TATCTTTGTCATCAAAACATAGG - Intronic
1159370833 18:67525785-67525807 GATTTTTAGCATCAGGACTTTGG - Intergenic
1164948223 19:32313983-32314005 CATCATTAGCATAAATTCATGGG + Intergenic
925488644 2:4367256-4367278 AATCTTTATCATAAAGATATAGG + Intergenic
927089917 2:19702590-19702612 CCTCTGTTGCATCAAGACACTGG + Intergenic
930371309 2:50504776-50504798 CATCTAGACCATCAAGTCATTGG + Intronic
931750798 2:65328132-65328154 TATCTTTAGCATTAAGGGATTGG - Intronic
933466252 2:82656398-82656420 CATTTTTATCAACAAGAAATAGG + Intergenic
936631142 2:114204255-114204277 CATCTTCTGTATTAAGACATTGG - Intergenic
937800190 2:126073591-126073613 CATAATTAGCATCACCACATTGG + Intergenic
941197263 2:162468333-162468355 ATTCTTTAGTATGAAGACATAGG - Intronic
941202646 2:162531596-162531618 CAACTTTGGGATCAAGACTTTGG + Intronic
941931889 2:170949604-170949626 TATCTATAGCAGCAAAACATTGG + Exonic
942352982 2:175073853-175073875 TATTTTTAGCCTCAAAACATAGG + Exonic
944891670 2:204123819-204123841 CATCTTTAGAATAAATACATCGG - Intergenic
1169689978 20:8319766-8319788 CTTATTTACCACCAAGACATGGG + Intronic
1170544433 20:17423028-17423050 CATCTTTATGATCATGACATAGG + Intronic
1173204472 20:40981958-40981980 CATCCCTAGCATCCAGACAGTGG + Intergenic
1173887771 20:46476704-46476726 CATCTTTAAAATGAAGGCATTGG - Intergenic
1175090851 20:56502822-56502844 CATATTTAGCTTCAGGAAATGGG + Intronic
1176277381 20:64280018-64280040 TATCTTTAGCATCCAGAGATTGG + Intronic
1177369953 21:20189468-20189490 CATGCTTAGAATCAAGCCATTGG + Intergenic
1177649436 21:23941475-23941497 CATCATTAACATTAAAACATAGG + Intergenic
1179104901 21:38390509-38390531 CCTCTTTTGCATAAGGACATTGG - Intronic
1181927591 22:26372411-26372433 CAGCTTTGGCATCAAGAAAATGG - Intronic
949141299 3:636497-636519 CATCTGTGGCATCAACACTTGGG + Intergenic
949366660 3:3288979-3289001 CAAGCCTAGCATCAAGACATGGG + Intergenic
951843955 3:27065413-27065435 TCTCTTTTGCATCAAGTCATGGG - Intergenic
954114140 3:48455369-48455391 CTTCTCTACCATAAAGACATTGG + Intronic
954216265 3:49126124-49126146 CATCTCTAGCACCAGGACACGGG + Exonic
955180525 3:56664763-56664785 CATTTTTAGAATCAACACATGGG + Intronic
959258504 3:104045616-104045638 CATATTTTGCAGCAAGAAATTGG + Intergenic
959284168 3:104386029-104386051 TATCTTTAGAATCAGGAAATTGG - Intergenic
961966192 3:130905719-130905741 CATCTTTATCATAAATAAATGGG - Intronic
961981169 3:131080712-131080734 CATTCTTAGCTGCAAGACATGGG - Intronic
962823800 3:139080609-139080631 CATCATTACCAGCAAGACAGAGG + Intronic
963359881 3:144257904-144257926 CATCTTTGGTAGCAAGACAGAGG - Intergenic
965617015 3:170604262-170604284 CATCTGCTGCATCAGGACATGGG - Intronic
966965012 3:184982332-184982354 CATCTTTATCATGAAGCCCTGGG - Intronic
968256821 3:197281792-197281814 CATCTTTAACATGAAGACAAGGG + Intronic
969134855 4:5021326-5021348 CACCTTTAGCAAGATGACATAGG + Intergenic
971246295 4:24931515-24931537 CATCTTTAGCTGCAACACCTGGG + Intronic
971384239 4:26128219-26128241 CATTTTTAGTATGAAGAAATAGG - Intergenic
972291901 4:37697410-37697432 CATCTTTATCCTGAAGAAATCGG + Intergenic
975731906 4:77345835-77345857 CATTTTTAGCATAAATTCATGGG - Intronic
979080545 4:116333971-116333993 CATATTTAGAAACAAGAAATTGG - Intergenic
979425752 4:120563508-120563530 AATCTTTAGCATCATAACCTTGG + Intergenic
980006794 4:127552099-127552121 CATGTTAATCATCAAGACAATGG + Intergenic
982123838 4:152167266-152167288 AATCTCTAGCTTCAAGACACTGG - Intergenic
982844993 4:160240510-160240532 CATAATGAGTATCAAGACATTGG - Intergenic
983252749 4:165363287-165363309 CAGATCTAGCCTCAAGACATAGG + Intronic
984219519 4:176955770-176955792 AATGTTAAGCATCAAGACAATGG - Intergenic
986104889 5:4650296-4650318 CATCTTCAGCACCAAGGCAAGGG - Intergenic
986876326 5:12115451-12115473 CATCTTCAACATCAAGATTTTGG - Intergenic
987461941 5:18223056-18223078 AATGTTAAGCATCAAGACAATGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
990988822 5:61665263-61665285 CATCTTTGACATTAACACATAGG + Intronic
991174900 5:63676211-63676233 CATCTTTTGCAATAGGACATCGG - Intergenic
995319381 5:110815081-110815103 CATCTTTGGGATCAAGAATTAGG + Intergenic
998057661 5:139092649-139092671 CATCTTTGGGCTCAAGACAACGG + Intronic
999705325 5:154267538-154267560 CATATTTTCCAGCAAGACATGGG - Intronic
1001343218 5:170866102-170866124 CATGTTTAGGATCAGGACTTTGG - Intronic
1004569454 6:16831353-16831375 CATCTTGGGCACCAAGCCATGGG - Intergenic
1004697259 6:18045273-18045295 AATTTTCAGCATCAGGACATGGG - Intergenic
1005236943 6:23775200-23775222 CATTTTTAGCATTGAGACAATGG - Intergenic
1005798062 6:29389160-29389182 CATCTTGAGCATTAACACTTTGG + Intronic
1007657090 6:43456835-43456857 CATCTTTAAATTCAAAACATCGG + Intergenic
1008636431 6:53415626-53415648 CAGCTTTAGCATCAATAAACTGG + Intergenic
1010005481 6:70991343-70991365 AATGTTAAGCATCAAGACAATGG + Intergenic
1013765481 6:113569519-113569541 TATCTTTAACATGAAGACAAGGG - Intergenic
1014575607 6:123067241-123067263 CCTCTATTGCATCAAGAAATTGG + Exonic
1016043304 6:139455085-139455107 CACTTTTACCATCAAGACAATGG - Intergenic
1017304770 6:152904288-152904310 CATCTTTGGTATGGAGACATAGG + Intergenic
1017637203 6:156455079-156455101 AATCTTTAACATCAAGAGAGTGG + Intergenic
1018069538 6:160151091-160151113 CATTTTTATCATCAGGATATAGG + Intronic
1021677951 7:23099704-23099726 CATCTTTGGCATCACAAGATAGG + Intergenic
1021964835 7:25907125-25907147 CATCTTTACCATCAGGAATTGGG + Intergenic
1022011649 7:26312985-26313007 CATCTGAATCATCAAGATATTGG - Intronic
1023473787 7:40554558-40554580 CATTCTTACCCTCAAGACATTGG - Intronic
1023714016 7:43024682-43024704 CATCTTTAGAATCATGAGTTAGG - Intergenic
1024689779 7:51787122-51787144 CATCTTTAGGATCTAGAGGTAGG - Intergenic
1026258587 7:68734433-68734455 CATCTTTCGTATCAAGAAGTAGG - Intergenic
1032552660 7:132799672-132799694 CATGTTTAGCAAGAAGAAATCGG + Intronic
1036119556 8:6001094-6001116 CATTTTTAGCTTGAAGACACTGG - Intergenic
1036190237 8:6663371-6663393 CACCTTTAGCAACAAGAACTTGG - Intergenic
1037232647 8:16677038-16677060 CATCTTTTGATTCAAGACAGTGG + Intergenic
1038290746 8:26247836-26247858 CTTCCATAGCCTCAAGACATTGG - Intergenic
1038975918 8:32695930-32695952 GATTTTTAGCATCCAGACACTGG - Intronic
1039635368 8:39158666-39158688 AATCTTTTGCTCCAAGACATGGG - Intronic
1041403918 8:57474989-57475011 CACCTTTAACATCATTACATTGG + Intergenic
1042412270 8:68479015-68479037 CATGTTTAGCATTAAAAAATAGG - Intronic
1043553441 8:81401769-81401791 CATCTTTTGCATCAATACACAGG - Intergenic
1044404225 8:91809041-91809063 CATCTGTAAGATAAAGACATAGG + Intergenic
1048123631 8:131608491-131608513 CATCTTTAGAATCTTGACTTTGG + Intergenic
1051636494 9:19185371-19185393 CATCTCTAGCATCCAGGCATTGG - Intergenic
1051715453 9:19978269-19978291 CATCTTTAGCAAAAGGACAGAGG + Intergenic
1052674264 9:31598507-31598529 CATCTTTAAAATGAAGATATTGG + Intergenic
1058874246 9:109229344-109229366 CTTCTTGACCATCCAGACATGGG - Intronic
1059216244 9:112566201-112566223 AATCTTTAGAATCAAAAGATAGG - Intronic
1186959166 X:14716261-14716283 CATCTTTAAAATGAAGAGATAGG - Intronic
1187795707 X:23001641-23001663 CATCATTAAGATCAAGACCTCGG - Exonic
1192158912 X:68768396-68768418 CATCTGTAACATGAAAACATTGG + Intergenic
1193698478 X:84737773-84737795 CATTTTTGGCATCCAGACGTGGG + Intergenic
1194884567 X:99297213-99297235 CAATTTGAGCATCAAGCCATTGG + Intergenic
1195862179 X:109394273-109394295 CATCTCTAGCATCAACACAGGGG + Intronic
1196415350 X:115465250-115465272 CCTCTTTAGTAGCAAGACATAGG + Intergenic
1197602799 X:128549474-128549496 AAGCTTTAGTATAAAGACATTGG + Intergenic
1198939218 X:141934683-141934705 CATTTTTGGCATCCAGATATGGG + Intergenic
1200399911 X:156013397-156013419 TATCTTTAGCATCCAGAGAGTGG + Intergenic
1200885218 Y:8260801-8260823 CTTCATTAGCTTCCAGACATTGG + Intergenic