ID: 1126937303

View in Genome Browser
Species Human (GRCh38)
Location 15:53725315-53725337
Sequence ATTCCTGTTGCTCCACATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 5, 2: 19, 3: 72, 4: 342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1126937303_1126937305 23 Left 1126937303 15:53725315-53725337 CCGGGATGTGGAGCAACAGGAAT 0: 1
1: 5
2: 19
3: 72
4: 342
Right 1126937305 15:53725361-53725383 GCAAAATAGGACAGCCACTTTGG 0: 1
1: 40
2: 393
3: 1123
4: 3423
1126937303_1126937304 10 Left 1126937303 15:53725315-53725337 CCGGGATGTGGAGCAACAGGAAT 0: 1
1: 5
2: 19
3: 72
4: 342
Right 1126937304 15:53725348-53725370 TGCTAGTGAGAATGCAAAATAGG 0: 1
1: 4
2: 43
3: 127
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1126937303 Original CRISPR ATTCCTGTTGCTCCACATCC CGG (reversed) Intronic
900355471 1:2260142-2260164 GTTCCTGCTGCTCCACGTCCTGG + Intronic
901531719 1:9857896-9857918 GTTCCAATTGCTCCACAACCTGG - Intronic
903134710 1:21302026-21302048 TTTCCTGCAGCTCCACATCAGGG - Intronic
903304831 1:22405944-22405966 GTTCCTTTTTCTCCACATCCTGG + Intergenic
903969748 1:27110926-27110948 ATTCCTCCTGCTCCAGGTCCTGG - Intronic
904305856 1:29589513-29589535 GTACCAGTTCCTCCACATCCTGG - Intergenic
905827450 1:41036798-41036820 ATTCATGTTGCCCCTCTTCCTGG + Intronic
907742860 1:57184132-57184154 AATCCTGCTGCCCCACATCCAGG + Intronic
908400448 1:63768067-63768089 GATCCAGTTGCTCCACATCCTGG + Intergenic
909771717 1:79431430-79431452 ATTGCTCTTGCTCCATGTCCTGG + Intergenic
910301301 1:85709748-85709770 GTTCCTATTTCTCTACATCCCGG + Intergenic
910472258 1:87567257-87567279 TTTCCTGTTCCTACACATCCTGG - Intergenic
912132812 1:106622610-106622632 ATTCGTTTTGCTGCACATTCTGG - Intergenic
912284455 1:108354193-108354215 ATTCCCTTTTCACCACATCCAGG - Intergenic
912868376 1:113280150-113280172 ATTCTTGTTCCTCCACAGCCTGG + Intergenic
912918571 1:113842717-113842739 ATTCCAATTTCTCTACATCCTGG - Intronic
913374798 1:118139322-118139344 GTTCCCTTTTCTCCACATCCTGG - Intronic
914389224 1:147203684-147203706 ATTTCTGTTGCTCCACCTCTGGG + Intronic
914764506 1:150626164-150626186 ATTTCTGTTTCTCCAGTTCCAGG - Intronic
914857371 1:151362588-151362610 ATTCCAGCTGCTCCAGCTCCAGG + Intergenic
915021286 1:152781576-152781598 ATGCCTTTTGCTTCACATGCTGG + Intronic
915558212 1:156671517-156671539 ATTCCTGATTCTCCTCTTCCAGG + Exonic
916985348 1:170185361-170185383 ATTCCTGATGCTCTCCCTCCTGG + Intergenic
917692011 1:177479366-177479388 ATGCCTGATGCTGCACAACCCGG - Intergenic
917785432 1:178451342-178451364 ATTGCTGTTATTCCACTTCCAGG + Intronic
918295337 1:183150832-183150854 ATTCCTGTTGCCCCATAACTTGG - Intergenic
918767479 1:188505714-188505736 ATTCTTGTTGCTGCACATTCTGG + Intergenic
918837312 1:189484024-189484046 ATTCCTATTTCTCCGCATCTTGG - Intergenic
919252379 1:195073429-195073451 ATTTCTCTTGCTCCAAATCCTGG + Intergenic
919456404 1:197825276-197825298 CTTCCTGTTTCTCCCCATCCTGG - Intergenic
919810063 1:201403429-201403451 GTTGCTGATGCTCCACATCCTGG - Intergenic
920077982 1:203350907-203350929 ATTCCTCCTTCTCCACATCTGGG - Intronic
920660075 1:207908232-207908254 ATCCCTTTGGCTCCACCTCCTGG - Intronic
920833669 1:209487993-209488015 ATTTATGTGGCTCCACAGCCAGG - Intergenic
920935072 1:210424978-210425000 GTTCCTTTTTCTCCACAACCTGG + Intronic
921008966 1:211122337-211122359 GTTCCTATTTCTCCACAGCCTGG - Intronic
921317084 1:213902708-213902730 ATTCCAGTTGCTCCTCATGCTGG - Intergenic
922484552 1:225963059-225963081 ATTCTCGTTCCTCCACCTCCAGG - Intergenic
1062846860 10:714205-714227 GTCCCTGATACTCCACATCCTGG + Intergenic
1063023352 10:2152919-2152941 ATTCTTGTTGCTTCATGTCCTGG - Intergenic
1064337762 10:14458999-14459021 GTGCCTGTTCCTCCACATCCAGG - Intronic
1064366072 10:14709056-14709078 GTTCCCACTGCTCCACATCCTGG - Intronic
1064516310 10:16152714-16152736 ATAACTGTTGCTCTCCATCCTGG + Intergenic
1064801618 10:19081126-19081148 ATTCCTTTTTCTCTGCATCCTGG - Intronic
1065057853 10:21865076-21865098 AGTGCAATTGCTCCACATCCTGG - Intronic
1065165437 10:22971826-22971848 GTTCCAATTTCTCCACATCCTGG + Intronic
1065296812 10:24283756-24283778 GTTCCTGTTGCTCTGCATCCTGG + Intronic
1065970631 10:30803489-30803511 ATTTCTGTTGGTTAACATCCTGG + Intergenic
1066297440 10:34067218-34067240 ATGCCTGTTGTTCCACATTTTGG - Intergenic
1066478609 10:35773193-35773215 GTTCCTGTTGCTCCACAACCTGG + Intergenic
1069608282 10:69754759-69754781 GTTCCAATTTCTCCACATCCTGG - Intergenic
1069676248 10:70250248-70250270 GTTCCAGTTGTTCTACATCCTGG - Exonic
1071644596 10:87350055-87350077 GTTCCTGTTTCTTCACATCCTGG - Intergenic
1072076315 10:91977695-91977717 GTTCCTGTTGATTCATATCCTGG + Intronic
1072557880 10:96537755-96537777 ATTTCTGTTCCTCCATCTCCCGG - Intronic
1072774418 10:98175538-98175560 ATTCCAGTTACACAACATCCTGG - Intronic
1073502207 10:103950690-103950712 ATTCCTCTAGTACCACATCCTGG - Intergenic
1074172258 10:110953196-110953218 GTTCCTGTTTCTCCACAGCCTGG + Intronic
1074450835 10:113558595-113558617 AATGCTGTTACTTCACATCCTGG + Intronic
1074470253 10:113720444-113720466 ATTCATGTTGCTTCACATTGTGG + Intronic
1076434073 10:130427587-130427609 CTTCCTGTCACTCCCCATCCAGG - Intergenic
1077449059 11:2624047-2624069 GTTCCTGTTGCCCCACATATTGG + Intronic
1079207565 11:18429889-18429911 ATTCTTGTTGTTTCAAATCCAGG + Exonic
1079795957 11:24803397-24803419 ATTCCAATTTCTCTACATCCTGG - Intronic
1080473368 11:32567775-32567797 AGTTCTGTTGCTCCACATCCTGG + Intergenic
1080989478 11:37513375-37513397 GTTCCCATTTCTCCACATCCTGG - Intergenic
1081370460 11:42294396-42294418 GTTTCTGTTGCTCCACATTCTGG + Intergenic
1081488663 11:43550011-43550033 CTTCCTATTACTCCACTTCCTGG - Intergenic
1081718461 11:45268140-45268162 ATTCCTGTTGTGTCTCATCCTGG - Intronic
1082723050 11:56702526-56702548 GTTCCCTTTACTCCACATCCTGG + Intergenic
1082745225 11:56953851-56953873 ATTCCCTTTTCTCCACAGCCTGG - Intergenic
1082748307 11:56992428-56992450 ATTCCCTTTTCTCCACAGCCTGG - Intergenic
1082784579 11:57309863-57309885 GTTCCTGTGGCTCCGCAGCCCGG + Exonic
1085188295 11:74595096-74595118 ATTTCAGTTTCTCCACATTCTGG + Intronic
1085451197 11:76634980-76635002 ATTCCAGGAGCTCCACTTCCAGG - Intergenic
1086436636 11:86787845-86787867 ATTCCTGTTTCACAACAACCTGG + Intergenic
1087769831 11:102196049-102196071 ATTCCAATTTCTCCACATTCTGG - Intronic
1088091045 11:106040377-106040399 GTTCCTTTTTCTCCACAACCTGG - Intergenic
1088201431 11:107339463-107339485 AATTCTGTTTCTCCATATCCTGG + Intronic
1089551268 11:119280499-119280521 ATGCCTGTTTCTTCACATCCTGG + Intronic
1089922598 11:122224148-122224170 CTTCCTTTAGCTCCACATCTTGG + Intergenic
1090460875 11:126890597-126890619 AGTCCCGTGGCTGCACATCCTGG + Intronic
1090607762 11:128440489-128440511 GTTCCAGTTGCTCTTCATCCTGG - Intergenic
1091539939 12:1450776-1450798 GTTCCAGTTTCTCCATATCCCGG + Intronic
1091933656 12:4417491-4417513 TCTCCTGTTGCTCAGCATCCAGG + Intergenic
1091953810 12:4619169-4619191 GTTTCAGTTTCTCCACATCCTGG - Intronic
1093251926 12:16816384-16816406 ATTCCCCTTTCTTCACATCCTGG - Intergenic
1093502916 12:19832775-19832797 GTTCCTATTTCTCCAAATCCTGG + Intergenic
1094238379 12:28193688-28193710 GTTCCAGTTGCTCCACATTCTGG + Intronic
1095759706 12:45816435-45816457 GTTCCTATTGCTCTCCATCCTGG - Intronic
1097901636 12:64879525-64879547 ATGCCTGCTTCTCTACATCCTGG + Intronic
1098212691 12:68183195-68183217 ATTCCTGTTGCTCAACATCCTGG - Intergenic
1098469958 12:70832126-70832148 GTTCCTGTCGCTCCATATGCTGG + Intronic
1098725220 12:73956239-73956261 ATGCCTGTTACTCCACAACCTGG + Intergenic
1099533264 12:83814185-83814207 ATTCTAGTTTCTCCACATCCTGG + Intergenic
1099762093 12:86936935-86936957 GTTCCTGTTGCTCCACAACCTGG - Intergenic
1103587999 12:121970494-121970516 ATTCCTCCTCCTCCTCATCCAGG + Intronic
1104639569 12:130458639-130458661 TCTCCTGTTTCTCCACACCCTGG - Intronic
1105257209 13:18751693-18751715 ATCCCTGTGGCTCCAGCTCCAGG - Intergenic
1107006471 13:35617720-35617742 GTTTCTGTTGCTCCAACTCCTGG + Intronic
1107029855 13:35839429-35839451 ATTCCTTTTGCTCAAAATCGGGG + Intronic
1107172720 13:37362213-37362235 ATTTCTCTTTATCCACATCCTGG - Intergenic
1107997015 13:45871039-45871061 TTTCTTGTGGCTGCACATCCTGG + Intergenic
1108942138 13:55969422-55969444 GTTCCTTTTTCTCCACATTCTGG - Intergenic
1109214838 13:59577886-59577908 ATTCCCTTTTCTCTACATCCTGG - Intergenic
1110210283 13:72963843-72963865 ATTACAATTTCTCCACATCCTGG - Intronic
1111301492 13:86356287-86356309 ATTCCTTTTTCTCCACAACCTGG + Intergenic
1114251200 14:20962857-20962879 GTTCCCTTTTCTCCACATCCTGG - Intergenic
1114889786 14:26904562-26904584 ATTCCCCTTTCTCCATATCCCGG - Intergenic
1115915904 14:38313577-38313599 ATTCCTTTTTCTCCACAACTTGG + Intergenic
1116143281 14:41029335-41029357 GTTCTTGTTGCTCCACATCTTGG + Intergenic
1116222453 14:42105986-42106008 ATTCCTCATGCTCCAGATCAAGG + Intergenic
1118783658 14:69027604-69027626 ATTGCTTTTGCTCCACTTCATGG - Intergenic
1119038749 14:71253995-71254017 GTTCCTGTTGTTCCATATCTTGG - Intergenic
1119349312 14:73950758-73950780 GTTCCAGTTTCTCCAGATCCTGG + Intronic
1120332417 14:83110926-83110948 GTTCCTGTTGCTCCATATCCTGG - Intergenic
1122169901 14:99863964-99863986 GTTCCTGTTGATCGGCATCCCGG + Intronic
1124246995 15:28079617-28079639 TTCCCTGTTGCTCCTCCTCCTGG + Intronic
1126924660 15:53570594-53570616 ATTCCTTTTTCTCCACAACCTGG - Intronic
1126937303 15:53725315-53725337 ATTCCTGTTGCTCCACATCCCGG - Intronic
1128097282 15:64967073-64967095 ATTCCAGTTTCTCTATATCCTGG - Intronic
1128340000 15:66815407-66815429 GTTCCTGTTGCTCCACATCCTGG - Intergenic
1129021436 15:72523000-72523022 GTTCCTACCGCTCCACATCCTGG - Intronic
1129495780 15:75978352-75978374 ATTCATGTTGCTGCACATGACGG + Intronic
1130065440 15:80599626-80599648 GTTCTAGTTGCTCCATATCCTGG - Intergenic
1130817777 15:87457475-87457497 ATTTCTGTTCCTCCAGTTCCAGG + Intergenic
1130881199 15:88057566-88057588 CTTCCCGTTGCTCCACCTTCTGG - Intronic
1130933732 15:88451077-88451099 ATTGCTGTTGGACCAAATCCTGG - Intergenic
1133147316 16:3798693-3798715 ATTCCAGGTTCTCCACGTCCTGG - Intronic
1133194787 16:4161431-4161453 GTTCCGATTTCTCCACATCCTGG - Intergenic
1133484062 16:6201434-6201456 ATTCCCCTTTCTCCACATCCTGG + Intronic
1133518982 16:6538601-6538623 ATTTCAGTTTCTCCACAGCCTGG - Intronic
1133815048 16:9190697-9190719 ATTCCTATTTCTCCACAGCTTGG + Intergenic
1133911973 16:10074236-10074258 TTTCTTATTTCTCCACATCCTGG - Intronic
1134009028 16:10837544-10837566 ATTCCTGTTGCTCCAAAGGGGGG - Intergenic
1134860593 16:17556909-17556931 ATTTCTGATGCTTCACATTCCGG - Intergenic
1135346299 16:21691445-21691467 GTTTCTATTTCTCCACATCCAGG + Intronic
1135477680 16:22791799-22791821 GGTCCAGTTTCTCCACATCCTGG - Intergenic
1137647209 16:50086269-50086291 CTCCCAGGTGCTCCACATCCAGG - Exonic
1137678860 16:50321184-50321206 ATTCCTATTGATACACTTCCCGG + Intronic
1137726282 16:50658892-50658914 GCTCCTGTTGCTCCACATGCTGG - Intergenic
1137966384 16:52937808-52937830 GTTCCTGTTGCTTCACATCCTGG - Intergenic
1138139416 16:54555166-54555188 GTTCCAGTTGCTCCACATCCTGG - Intergenic
1138502843 16:57458901-57458923 ATTTCTGTGCCTCCTCATCCAGG - Intronic
1143431524 17:6891078-6891100 ATTCCTGTGGCTCCATATGAAGG + Intronic
1145293591 17:21570783-21570805 ATTCCTATTTCTCCACAGCCTGG - Intronic
1145386387 17:22415156-22415178 ATTCCTATTTCTCCACAGCCTGG + Intergenic
1146380607 17:32324434-32324456 ATTCATGTTGCTCCCCGTGCTGG + Exonic
1146601642 17:34222177-34222199 TTTCCTCATGCTCCACTTCCTGG + Intergenic
1146718596 17:35106984-35107006 TTACCTGTTCCTCCTCATCCTGG + Exonic
1146909421 17:36638976-36638998 CTTCCTGGGGCTTCACATCCAGG - Intergenic
1148830684 17:50429047-50429069 TTTCCTGTTGCCCAACACCCAGG + Intronic
1149112124 17:53046565-53046587 ACCCTTATTGCTCCACATCCAGG + Intergenic
1149744754 17:59085551-59085573 GTTCCAGTTTCTCCACATCCTGG - Intronic
1150544612 17:66142010-66142032 ATTCCCTTTTCTCCAAATCCTGG + Intronic
1150970808 17:70025479-70025501 ATTCCTTTTTCTTCACAACCTGG + Intergenic
1151110617 17:71673215-71673237 ATTCCTGTTGATGCACAATCTGG - Intergenic
1151948564 17:77333092-77333114 GTTCTAGTTGCTCCACATCCTGG + Intronic
1152866578 17:82727230-82727252 ATTCTTGTTTCTTCACATGCTGG + Exonic
1152940021 17:83164100-83164122 GCTCCTGTTGCTACACATCCTGG + Intergenic
1153172072 18:2327809-2327831 ATTCCTGTCTTTCCACCTCCTGG + Intergenic
1153397037 18:4635088-4635110 GTTCCTCTTTCTCTACATCCTGG - Intergenic
1153670647 18:7408865-7408887 GTTCCATTTTCTCCACATCCTGG + Intergenic
1154006945 18:10539011-10539033 TTTCCTATTTCTCCACAGCCTGG - Intronic
1154167276 18:12025502-12025524 GTTCCTGTTGCTCCACATCCTGG + Intronic
1154947348 18:21175491-21175513 GTTCCAGTTGCTCTGCATCCTGG - Intergenic
1155590103 18:27418249-27418271 ATTCCAATTTCTCCATATCCTGG + Intergenic
1157691480 18:49685556-49685578 GTCCCTGTTGCTCCAGTTCCAGG - Intergenic
1158030320 18:52955678-52955700 GTTCCTCTTGCTCCACAACCTGG + Intronic
1158098382 18:53801508-53801530 ATTCCTTTTTCTCCACAATCTGG + Intergenic
1158390594 18:57041762-57041784 ATTCTTGTTGTTTCACTTCCTGG + Intergenic
1158659941 18:59377858-59377880 TTTCTTGTTGCTCGATATCCAGG - Intergenic
1158930301 18:62318286-62318308 GTTGCACTTGCTCCACATCCTGG - Intergenic
1158961679 18:62592894-62592916 GTTCCAGTTGCTCCACATGTTGG - Intergenic
1159754176 18:72343181-72343203 ATTCCCTTTTCTCCACATCCTGG - Intergenic
1160169208 18:76538951-76538973 CTTCCTGTTGCTCCAGCTCTTGG + Intergenic
1160179180 18:76619549-76619571 GTTCCTGTTGCCCAACATCCTGG + Intergenic
1160848961 19:1180569-1180591 CTTCCTGTTTCTCCACATTCTGG + Intronic
1161253058 19:3291599-3291621 ATGCCTGGTGCTCCTCATTCAGG - Intronic
1162992884 19:14314736-14314758 TTTCCTGGTCCTCCTCATCCCGG - Intergenic
1163531121 19:17849416-17849438 ATTCCTGAAGCTCTACTTCCGGG - Intergenic
1164783892 19:30914239-30914261 TTTCCTGTTGTTCCCCATGCTGG + Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1165646166 19:37439415-37439437 GTTCCCTTTTCTCCACATCCTGG - Intronic
1165694222 19:37888387-37888409 ATTCCAGTTCCTCCAATTCCTGG + Exonic
1165703696 19:37959037-37959059 GTTCCAATTTCTCCACATCCTGG - Intronic
1167742025 19:51329513-51329535 TTTCCTGTCCCTCCACACCCTGG + Exonic
1167998129 19:53423241-53423263 ATTTTTGTTGCTCCACTTGCCGG - Intronic
1168007607 19:53503835-53503857 ATTTTTGTTGCTCCACTTGCCGG - Intergenic
925108509 2:1313381-1313403 ATTTTTTTTGCTCCACATCCTGG - Intronic
925211591 2:2052791-2052813 ATTCCAATTTCTCCATATCCAGG - Intronic
928720913 2:34119767-34119789 TCTCATGTTTCTCCACATCCAGG - Intergenic
929426619 2:41850761-41850783 CTTCCTCCTGCTTCACATCCAGG - Intergenic
929428021 2:41863786-41863808 AACCCTGTTGCTCCACTGCCTGG + Intergenic
930196292 2:48514104-48514126 AGTCTTGTTGCTCCATCTCCCGG + Intronic
930350789 2:50251661-50251683 ATTCCTCTTTCTCCAGAGCCTGG + Intronic
930881912 2:56279727-56279749 ATTCCTGTTGCTGCAAATACAGG + Intronic
930987398 2:57607285-57607307 ATTCCTATTTCTCCACAGCCTGG - Intergenic
931015817 2:57979295-57979317 ATTCCTATTTCTCCATAGCCTGG + Intronic
931236258 2:60415006-60415028 GTTCCAGTTGCTCCACATCTTGG + Intergenic
931453913 2:62391940-62391962 GTTCCCCTTTCTCCACATCCTGG + Intergenic
931795469 2:65704519-65704541 ATTACTGTTGTTCCAAAACCAGG + Intergenic
931838081 2:66120742-66120764 ACTCCTGTTGCTCCACATTCTGG + Intergenic
932162646 2:69475963-69475985 ATTCCTATCTCTCCACTTCCAGG - Exonic
932267330 2:70379143-70379165 GTTCCAATTTCTCCACATCCTGG + Intergenic
932389305 2:71371477-71371499 GTTCCCTTTTCTCCACATCCTGG + Intronic
932404038 2:71502026-71502048 ATTCCAGTTTCTCCATATCCTGG + Intronic
933554709 2:83817725-83817747 GTTCCTTTTTCTCCACAACCTGG + Intergenic
936776387 2:115978882-115978904 ATTCCTCTTTCACCACATCGAGG + Intergenic
937360572 2:121226757-121226779 GTTCCTGTTGCTCTACATTCTGG - Intronic
937528158 2:122796254-122796276 TGTCATGTTGCTCCATATCCTGG + Intergenic
937923294 2:127147288-127147310 ATCCCTGTGGCTGCACGTCCTGG + Intergenic
939376630 2:141376345-141376367 CTTACTGTTTCCCCACATCCAGG + Intronic
939546195 2:143557006-143557028 GTTCCTGTTGCTCCACATCTTGG - Intronic
939610887 2:144309125-144309147 ATTCTAGTTGCTCCACATTCTGG - Intronic
941026463 2:160461448-160461470 ATTCCTGTCCCTCCACTTACTGG - Intronic
943536091 2:189152592-189152614 GCTCCTGTTGCTCCACCCCCTGG + Intronic
944437983 2:199711805-199711827 ATTCCTGGGTTTCCACATCCTGG + Intergenic
945174011 2:207023481-207023503 GGTCCTGTATCTCCACATCCTGG + Intergenic
945402209 2:209397602-209397624 ATTCCCTTTGCTCTACATCTGGG + Intergenic
945896711 2:215491186-215491208 ATTCGTGTTGTTCCACATCCTGG + Intergenic
945897028 2:215495023-215495045 ATTCCTGTTGTTCCACATCCTGG - Intergenic
946094899 2:217265443-217265465 GTTCCAATTTCTCCACATCCTGG + Intergenic
946266043 2:218542424-218542446 ATTCTTGTTTCTGCACATCAGGG - Intronic
946390653 2:219414609-219414631 GTTCCAATTTCTCCACATCCTGG - Intergenic
946436166 2:219656618-219656640 AATCCAGTTTCTCCACATCCTGG - Intergenic
947858049 2:233337823-233337845 ATTCCTGTTATTGGACATCCTGG + Intronic
948278605 2:236729102-236729124 ATACCTGTTTATCCTCATCCTGG - Intergenic
948603222 2:239119299-239119321 ATCCCTCCTGCTCCTCATCCAGG - Intronic
948747263 2:240105825-240105847 CACCCTGGTGCTCCACATCCTGG - Intergenic
949021525 2:241743665-241743687 AGTCCCGTTCCTCCACATACCGG - Exonic
1169617466 20:7465010-7465032 TTTCCCTTTTCTCCACATCCTGG + Intergenic
1169743441 20:8919461-8919483 ATTCCTGTTGCTCAGCTTCAAGG - Intronic
1170385379 20:15810494-15810516 GTTCCTGTTTCTCCACATCAAGG + Intronic
1170426393 20:16239222-16239244 ATTCCAGTTTCTTCACATCCTGG - Intergenic
1170607356 20:17883951-17883973 ATCCCTGGTCCTCCACTTCCTGG + Intergenic
1170892732 20:20389810-20389832 TTTCCTAATGCTCCACATCTAGG - Intronic
1170975451 20:21159982-21160004 ATTCTAATTTCTCCACATCCTGG + Intronic
1173788271 20:45811063-45811085 ATTCCTCTAGCTTCAGATCCAGG - Exonic
1175180624 20:57144147-57144169 GTTCTGGTTTCTCCACATCCTGG - Intergenic
1175510008 20:59517647-59517669 ATTCCTGTTGCTCCACCCAGAGG + Intergenic
1175840677 20:62025051-62025073 GCTCTGGTTGCTCCACATCCTGG - Intronic
1177514717 21:22134583-22134605 ATTCCTGGTGCCCCACCTCAAGG + Intergenic
1177820374 21:26024413-26024435 CTTCCTGTGGCTACAAATCCCGG - Intronic
1178080708 21:29061530-29061552 ATTTCTGTTGCTCCACCTCCGGG + Exonic
1179830995 21:43995814-43995836 ATCCCAGTGGCTCCAGATCCTGG + Intergenic
1180010336 21:45045595-45045617 GTTCCTGTTGCTCCACACCCTGG - Intergenic
1181076784 22:20383874-20383896 ATTCCCCTTTCTCCACATCCTGG + Intronic
1181658575 22:24322119-24322141 ATTCCCGCTGCTCCCCTTCCGGG - Exonic
1182415590 22:30219176-30219198 GTTCTGGTTTCTCCACATCCTGG - Intergenic
1184220017 22:43094075-43094097 GTTCCAATTCCTCCACATCCTGG + Intergenic
949703618 3:6788566-6788588 GTTGCTCTTACTCCACATCCTGG + Intronic
950049799 3:9978954-9978976 ATTCTAGTTTCTCCACATGCTGG + Intronic
950872695 3:16243237-16243259 ATTCATCTTGCACGACATCCAGG - Intergenic
952628134 3:35431599-35431621 GTTCCTGTTGCTCCACATCCTGG + Intergenic
952676301 3:36034987-36035009 GTTCCCCTTTCTCCACATCCTGG + Intergenic
953173501 3:40528631-40528653 AGTTCTGTTGTTTCACATCCTGG + Intronic
955512838 3:59698552-59698574 ATTCCTGGAGCCACACATCCAGG - Intergenic
955613014 3:60777580-60777602 ATTCCTTTCTCTCCAGATCCAGG - Intronic
956751314 3:72346142-72346164 ACTCTTGCTGCTCCACACCCGGG + Intergenic
957898559 3:86455766-86455788 GATCCTGTTTCTGCACATCCTGG - Intergenic
958084134 3:88784389-88784411 GTTCCTGTTGCTCCACAACCTGG - Intergenic
958434744 3:94082607-94082629 ATTCCAGCTGCTACACACCCTGG - Intronic
958602542 3:96315898-96315920 GTTCCTTTTTATCCACATCCTGG + Intergenic
959774077 3:110135341-110135363 AGGCCTGTTTCTCCCCATCCAGG - Intergenic
959848975 3:111066290-111066312 TTTGTTGTTGCTCCTCATCCAGG - Intergenic
960976207 3:123177193-123177215 ATTCTGATTTCTCCACATCCTGG - Intronic
962118275 3:132534934-132534956 ATTCCTGGAGTTCCACATCATGG - Intronic
962214898 3:133512819-133512841 ATTCCTGGACCTCTACATCCTGG - Intergenic
962734567 3:138313903-138313925 ATTCCTCTCTCTCCACTTCCTGG - Intronic
962883509 3:139601259-139601281 ATTCCTGTTACTGCAAAGCCTGG - Intronic
963026937 3:140929212-140929234 TTTCCAATTTCTCCACATCCTGG + Intergenic
963370855 3:144397890-144397912 ATTCCCTTTGCTTCACATCATGG + Intergenic
963439568 3:145320931-145320953 ATCCCTGTTACTCCACATCCTGG - Intergenic
963668575 3:148222454-148222476 AGCCCTGTTCCTCCACTTCCAGG - Intergenic
964264950 3:154885069-154885091 GTTCCTGTTGCTTGGCATCCTGG - Intergenic
964276979 3:155019350-155019372 ATTCCTGTTATTCTACTTCCAGG - Intergenic
964785304 3:160389960-160389982 GTTCCTATTTCTCCACATCCTGG + Intronic
964808352 3:160636209-160636231 GTTCCAGTTTCTCCACATCATGG + Intergenic
964954669 3:162337902-162337924 ATTTCTGGTGCTCTATATCCTGG + Intergenic
965888377 3:173477914-173477936 CTTCCTATTTCTCCACAACCTGG - Intronic
967376513 3:188809313-188809335 GTTCCTATTTCTCCACAGCCTGG + Intronic
967696444 3:192537432-192537454 ATTCCCTTTTCTCCACATGCTGG + Intronic
967879478 3:194289889-194289911 AATCCAGTTTCCCCACATCCTGG - Intergenic
968021395 3:195393750-195393772 TTTCCTATTGCTGCACATCTAGG - Intronic
969433069 4:7167310-7167332 ATTCCTGTTGTTCAAGACCCCGG - Intergenic
970180932 4:13392590-13392612 ATTCCCTTTCCTCCATATCCTGG + Intronic
971265575 4:25093759-25093781 CCTCCTGGTGCTCCACATGCAGG + Intergenic
972383960 4:38545645-38545667 GTTCCCTTTCCTCCACATCCTGG + Intergenic
973138585 4:46737082-46737104 GTTTCTTTTGTTCCACATCCTGG + Intronic
974287312 4:59885672-59885694 AAACCTCTTGCTCCACATCTGGG + Intergenic
974730844 4:65864057-65864079 ATTCCTATTTCTCCACAGCCTGG - Intergenic
975463510 4:74683097-74683119 AGTCCTGAGGCTCCACTTCCAGG - Intergenic
975898608 4:79123133-79123155 GTTCCCTTTTCTCCACATCCTGG + Intergenic
977953251 4:102998662-102998684 ATTCCAGTTTCTCCACATGCAGG + Intronic
979169793 4:117586384-117586406 ATTCCAGTTGCTCCACACCTTGG - Intergenic
980460171 4:133099819-133099841 ATTCCTTTTTCTCTACAACCTGG + Intergenic
981012857 4:139943655-139943677 ATTCAAGTTGATACACATCCAGG - Intronic
981054703 4:140348842-140348864 ATTCCCTGTTCTCCACATCCTGG + Intronic
982052832 4:151519786-151519808 AATTCTGTTGCTCCATATCCTGG + Intronic
982236072 4:153252298-153252320 GTTCCTGTTCTTGCACATCCTGG + Intronic
982816437 4:159891333-159891355 ATTCCTGTTGCTCCACATAAAGG + Intergenic
983535896 4:168856477-168856499 ATTCCCTTTTCTCCACATCCTGG + Intronic
984586763 4:181573371-181573393 ATTCCCTTTTTTCCACATCCTGG + Intergenic
986880825 5:12168887-12168909 GTTCCTATTTCTCCACAGCCTGG - Intergenic
987548091 5:19339809-19339831 CTTCCTTTTTCTCCACAACCTGG + Intergenic
987915944 5:24214703-24214725 GTTCCTGGTGCTCAACAACCTGG + Intergenic
990130229 5:52573144-52573166 ATTGCTGTTGCTGCACAACTTGG - Intergenic
991408460 5:66324360-66324382 TATCCTGCTGCTCCACCTCCTGG + Intergenic
992581981 5:78188588-78188610 ATTCCTATTTCTCCGCAGCCTGG - Intronic
993852578 5:93029476-93029498 ATCCCATTTGCTCCACATTCCGG + Intergenic
993935782 5:94000292-94000314 GTTCCTATTGCTCCACATCCTGG + Intronic
994411430 5:99411119-99411141 GTTCTAGTTGCTTCACATCCTGG + Intergenic
994482397 5:100354128-100354150 GTTCTAGTTGCTTCACATCCTGG - Intergenic
995040756 5:107585317-107585339 ATTCCTATTGCACTACATCAAGG + Intronic
995329214 5:110928146-110928168 ATTCCTTTTTCTCCACAACCTGG + Intergenic
995660931 5:114482387-114482409 ATTCCTCTTTCTCCGCAACCTGG - Intronic
996392371 5:122975077-122975099 TTTCTTGATTCTCCACATCCAGG + Intronic
997270317 5:132531178-132531200 ATTCCTTTTACTTTACATCCTGG + Intergenic
998101746 5:139440264-139440286 ATTCTTGCTGTTCCTCATCCAGG + Intronic
998605527 5:143630529-143630551 ATTCCTGGTGCTATACATTCTGG + Intergenic
998801154 5:145870727-145870749 ATTCATGTAGCTGCACACCCTGG - Intronic
998917135 5:147026806-147026828 GTTCCAGTTGCTCCACATAATGG - Intronic
999793109 5:154961596-154961618 AATCCTGTTGCTCCAAATGAAGG + Intronic
1000238667 5:159387970-159387992 CTTACTGTTTCCCCACATCCAGG + Intergenic
1004175878 6:13339712-13339734 ATTCCAGTTGTACCACCTCCTGG - Intergenic
1004806280 6:19206823-19206845 ATTCCAGTTGCTCTGCATCCTGG + Intergenic
1004917327 6:20344092-20344114 GTTTCTGTTTCCCCACATCCAGG - Intergenic
1005215136 6:23517898-23517920 ATTCCTGTGGCTCCACAGAAAGG - Intergenic
1005992344 6:30911203-30911225 GTTCCTGTTGCTGGACACCCCGG + Exonic
1006958950 6:37906661-37906683 GTTCCAGTTTCTCCACATACTGG + Intronic
1007127716 6:39441484-39441506 ATTCATGTTCCTCCACCTCCAGG + Intronic
1007135295 6:39515228-39515250 ATTCCTGTTTCTAGACATTCAGG - Intronic
1008394193 6:50988082-50988104 ATTCCCCTTTCTCCACATCCTGG - Intergenic
1009028444 6:58027830-58027852 ATTCTGGCTGCTCCACATCTGGG + Intergenic
1009203974 6:60779214-60779236 ATTCTGGCTGCTCCACATCTGGG + Intergenic
1009263723 6:61528010-61528032 ATTCCTCTGGTTCCATATCCAGG - Intergenic
1010832860 6:80552355-80552377 ATCCCTGTTCCTCCCCTTCCAGG + Intergenic
1011036950 6:82987590-82987612 ATTCCCATTGCTTCACATCATGG - Intronic
1012485411 6:99716016-99716038 ATTCTCCTTTCTCCACATCCTGG + Intergenic
1012925980 6:105268265-105268287 GCTCCTGTTGGTCCACATTCTGG - Intergenic
1013321817 6:108999634-108999656 ATTCCTGTTGTCCCACATCTTGG - Intronic
1013380084 6:109559920-109559942 ATTCCTGCTTCTCCACTTCTAGG + Intronic
1013558409 6:111280809-111280831 ATTCCACTTTCTCCACATCCTGG + Intergenic
1014120120 6:117715237-117715259 ATTCATGTTGTTCCAAATACCGG + Intergenic
1014357137 6:120426788-120426810 ATTCCTTTTTCTCCACAACTTGG - Intergenic
1015280296 6:131426320-131426342 ATTCATGTTGTTCCAATTCCTGG + Intergenic
1015640378 6:135325728-135325750 GTTCCTGTTGTTCCTTATCCTGG + Intronic
1015668779 6:135663654-135663676 AATCCCTTTCCTCCACATCCTGG - Intergenic
1016238359 6:141896212-141896234 ATTCCTATTTCTCCACAGCCTGG - Intergenic
1017811627 6:157988059-157988081 ATTCCTGCTGCTCAAGACCCTGG + Intronic
1018164919 6:161084330-161084352 ATTCCTATTTTTCCACGTCCAGG + Intronic
1018553278 6:165023457-165023479 ATTCTTGTTGTTCCACATCCTGG - Intergenic
1019014690 6:168871322-168871344 CATCCTCTTGCTCCACTTCCAGG - Intergenic
1019762791 7:2826001-2826023 GTTCCTGTTGCTCCACTTCCTGG - Intronic
1020575032 7:9915311-9915333 ATTTCAATTTCTCCACATCCTGG + Intergenic
1023053992 7:36277208-36277230 GTTCCTGCTGCTCTACTTCCTGG - Intronic
1023109882 7:36799066-36799088 CTTCGTGTTGCTCCATATTCAGG + Intergenic
1023128509 7:36978767-36978789 ATCACTGTAGCTCCACATTCTGG + Intronic
1023851189 7:44151399-44151421 ATTCCTGAGGCTCCACATGGAGG + Intronic
1024488723 7:49951581-49951603 GTACCTGTTTCTTCACATCCTGG - Intronic
1024703394 7:51928957-51928979 ATGGCTGTTCTTCCACATCCTGG - Intergenic
1026157732 7:67841785-67841807 ATTCCCTTTTCTCCACAACCTGG - Intergenic
1027142861 7:75671693-75671715 ATTCCAATTTCTCCACAACCTGG + Intronic
1027982370 7:85241925-85241947 GTTCCCTTTTCTCCACATCCTGG - Intergenic
1028245062 7:88467204-88467226 ATTCCTATAGCTACACATGCAGG - Intergenic
1028341251 7:89722580-89722602 ATTCCAGATCCTCAACATCCTGG - Intergenic
1028838762 7:95403226-95403248 GCTCCTATTACTCCACATCCTGG - Intergenic
1031851719 7:126872775-126872797 ACTCCTCTTGGTCCACCTCCGGG + Intronic
1032302954 7:130706687-130706709 GTTCCCGTTGCTCCACATTTTGG + Intergenic
1033072378 7:138215912-138215934 ATTCCTCTTAATCCACATCATGG - Intergenic
1034133335 7:148741380-148741402 GTTCCAGTTTCTCCACATTCTGG + Intronic
1034367843 7:150567364-150567386 TCTCCTGTTTCTCAACATCCTGG + Exonic
1034892887 7:154856036-154856058 AGTCCTGTGTCTCCACTTCCGGG - Intronic
1036831565 8:12024301-12024323 ATTCCTCTTCCTCTACATGCAGG + Intergenic
1037916746 8:22777641-22777663 ACTCCTGTTGCCCCAGAGCCGGG + Intronic
1038180742 8:25225108-25225130 GTTCCAATTTCTCCACATCCTGG - Intronic
1038555447 8:28510061-28510083 ATTCCAATTTCTCCACATCTTGG + Intronic
1038933688 8:32223960-32223982 ATTCCTGTTCCTCTCCTTCCAGG - Intronic
1039047129 8:33460665-33460687 CTTCCTGTTTCTCTACAACCAGG + Intronic
1039090364 8:33821735-33821757 ATTCCTTTTGCTCTACATGCAGG - Intergenic
1039371755 8:36991691-36991713 ATTCATGTAACTCAACATCCAGG + Intergenic
1039628800 8:39085894-39085916 CTTCCTCTTTCTCCTCATCCAGG + Intronic
1039814630 8:41082282-41082304 ATGCCTGTTCCTCCACTTGCTGG - Intergenic
1040630779 8:49207445-49207467 ATTCTTATTGTTCCACAACCTGG + Intergenic
1042863752 8:73338697-73338719 GTTCCTGTTGCTCTGCACCCCGG - Intergenic
1043828381 8:84957389-84957411 GTTCCTTTTTCTCCACAGCCTGG - Intergenic
1045138927 8:99256521-99256543 GTTCCGATTACTCCACATCCTGG + Intronic
1045528523 8:102962199-102962221 ATCCCTGTTCCTCCACAACAGGG - Intronic
1046429839 8:114110168-114110190 ATTCCTTTTTCTCCACAACCTGG - Intergenic
1048027914 8:130603774-130603796 ATTCCTTTTTCACCACATCCAGG + Intergenic
1048411575 8:134180067-134180089 ATTCCTTTTTTTCCCCATCCTGG + Intergenic
1049468764 8:142765633-142765655 ATTCCTGTTCCACCACATCCTGG - Intronic
1049693974 8:143974740-143974762 TTTCCAGTAGCTCCCCATCCAGG - Intronic
1050459774 9:5867676-5867698 ATCCCTGTCTCTCCACATCCCGG + Intergenic
1050550523 9:6744980-6745002 ATTCCTCCTCCTCCACCTCCTGG + Intronic
1051113701 9:13669868-13669890 ATTCCTGTTACTTCATATGCTGG - Intergenic
1051313037 9:15797021-15797043 GTTCCATTTGCTTCACATCCTGG + Intronic
1051990667 9:23148259-23148281 ATTCCCTTTTCTCCACATCCTGG + Intergenic
1052018882 9:23502074-23502096 ATTCTAGTTGCTTTACATCCTGG + Intergenic
1052182066 9:25541804-25541826 ATTATTTTTACTCCACATCCTGG - Intergenic
1053040786 9:34869384-34869406 ATTCCTTTTTCTCCACAACCTGG + Intergenic
1053372243 9:37572252-37572274 GTTCCAGTTGCTTCATATCCTGG - Intronic
1053565826 9:39249885-39249907 ATTCCAGTTGCTTCTTATCCTGG - Intronic
1054131326 9:61369153-61369175 ATTCCAGTTGCTTCTTATCCTGG + Intergenic
1054598957 9:67099713-67099735 ATTCCAGTTGCTTCTTATCCTGG + Intergenic
1055039072 9:71849463-71849485 GTTCCTATTTCTCCACAGCCTGG - Intergenic
1056242650 9:84664161-84664183 GTTCCAGTTGCTCCACATTCTGG + Intergenic
1056462633 9:86823084-86823106 ATTGCTGTGTCTCCACATCAAGG + Intergenic
1057158118 9:92862777-92862799 GTTCCTATTTCTCCACAACCTGG - Intronic
1057560142 9:96121441-96121463 GTTCCCTTTTCTCCACATCCTGG - Intergenic
1058268040 9:102932180-102932202 GCTCCTGTTGCTTCAGATCCTGG - Intergenic
1059466951 9:114475011-114475033 GTTCCTCTTCCTCCACATCCTGG - Intronic
1060825216 9:126683859-126683881 ATTCCTTCTGCTCCAGAACCGGG + Intronic
1061158606 9:128880417-128880439 ATTCCAGCTTCTCCACTTCCTGG + Intronic
1062472256 9:136711826-136711848 CTTCCAGCTGCTCCGCATCCCGG - Intergenic
1185693671 X:2177836-2177858 GTTCCTGTTTCTCCACATCCAGG - Intergenic
1185895018 X:3850379-3850401 ATTCCCATTTCTCTACATCCTGG - Intergenic
1185900136 X:3888804-3888826 ATTCCCATTTCTCTACATCCTGG - Intergenic
1185905252 X:3927232-3927254 ATTCCCATTTCTCTACATCCTGG - Intergenic
1186858198 X:13646010-13646032 ATTCCTGCTGCTCAAGAGCCTGG + Intergenic
1188892576 X:35628916-35628938 ATTCCTTTTTCTCCACAACCTGG + Intergenic
1189445990 X:41082164-41082186 GTTCCAATTTCTCCACATCCTGG + Intergenic
1189995200 X:46631159-46631181 ATTCCTGTTTCTCCAGGGCCTGG - Intronic
1190409532 X:50122026-50122048 ATTCCAGTTACTCCATATCCTGG + Intergenic
1191201421 X:57786513-57786535 TTTCCTAATTCTCCACATCCTGG - Intergenic
1192385038 X:70659564-70659586 GTTCCAATTTCTCCACATCCTGG - Intronic
1193221993 X:78936299-78936321 AATCCTCTTTCTCCACGTCCTGG + Intergenic
1194173193 X:90614515-90614537 GTTCCCTTTTCTCCACATCCTGG + Intergenic
1195362578 X:104098334-104098356 ATTCCCATTGCTCCACCTGCTGG - Intergenic
1196023887 X:111019927-111019949 GTTCCTATTTCTCCACATCCTGG - Intronic
1197479913 X:126969956-126969978 ATTCCTTTTTCTCTACAACCTGG - Intergenic
1198111613 X:133507225-133507247 GTTCCAGTTTCTCCACATCTTGG - Intergenic
1198813841 X:140565565-140565587 ATTCCATTTGCTCCACATCTAGG + Intergenic
1198934572 X:141893203-141893225 GCTCCTGTTGCTCAACATACAGG - Intronic
1199912582 X:152303324-152303346 GTTCCTATTCCTCCACATCCTGG - Intronic
1200120581 X:153788423-153788445 CTTTCTGTTGCTCCAGAGCCTGG - Intronic
1200270833 X:154681224-154681246 ATTTCTATTGCTTCCCATCCTGG + Intronic
1200519409 Y:4192230-4192252 GTTCCCTTTTCTCCACATCCTGG + Intergenic